\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611689492:

Variant ID: vg0611689492 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11689492
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGAAAAAAATAAAAAAAATCAATCATGTAAAATTGTTGTTACTAGAATTTTTTTATTAAATAAACTATCACTGTCATAATAAGTAACTCATTTTATTTA[T/A]
AACATCTTGTTTATATATATATATTTGTCATGGTTACAAACATCTTATTTTTATATATATTTGTCATGGTTACAAATATGGTATACCTCTTATCCTACGA

Reverse complement sequence

TCGTAGGATAAGAGGTATACCATATTTGTAACCATGACAAATATATATAAAAATAAGATGTTTGTAACCATGACAAATATATATATATAAACAAGATGTT[A/T]
TAAATAAAATGAGTTACTTATTATGACAGTGATAGTTTATTTAATAAAAAAATTCTAGTAACAACAATTTTACATGATTGATTTTTTTTATTTTTTTCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.40% 18.50% 0.04% 0.00% NA
All Indica  2759 99.30% 0.70% 0.04% 0.00% NA
All Japonica  1512 47.20% 52.70% 0.07% 0.00% NA
Aus  269 89.20% 10.80% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.90% 1.00% 0.13% 0.00% NA
Temperate Japonica  767 20.30% 79.50% 0.13% 0.00% NA
Tropical Japonica  504 82.10% 17.90% 0.00% 0.00% NA
Japonica Intermediate  241 59.80% 40.20% 0.00% 0.00% NA
VI/Aromatic  96 81.20% 18.80% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611689492 T -> A LOC_Os06g20340.1 upstream_gene_variant ; 1577.0bp to feature; MODIFIER silent_mutation Average:56.518; most accessible tissue: Callus, score: 85.29 N N N N
vg0611689492 T -> A LOC_Os06g20354.1 upstream_gene_variant ; 3539.0bp to feature; MODIFIER silent_mutation Average:56.518; most accessible tissue: Callus, score: 85.29 N N N N
vg0611689492 T -> A LOC_Os06g20340.2 upstream_gene_variant ; 3284.0bp to feature; MODIFIER silent_mutation Average:56.518; most accessible tissue: Callus, score: 85.29 N N N N
vg0611689492 T -> A LOC_Os06g20340-LOC_Os06g20354 intergenic_region ; MODIFIER silent_mutation Average:56.518; most accessible tissue: Callus, score: 85.29 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611689492 NA 2.59E-07 mr1091 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492 NA 4.45E-13 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492 NA 1.48E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492 NA 1.56E-07 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492 NA 5.12E-08 mr1094_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492 NA 2.20E-08 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492 NA 4.76E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492 NA 5.94E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492 NA 1.87E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492 NA 9.74E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492 4.60E-06 4.60E-06 mr1234_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492 NA 7.37E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492 NA 1.59E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492 NA 2.10E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492 NA 6.19E-08 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492 NA 7.68E-06 mr1763_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492 NA 5.37E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251