Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611689492:

Variant ID: vg0611689492 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 11689492
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGAAAAAAATAAAAAAAATCAATCATGTAAAATTGTTGTTACTAGAATTTTTTTATTAAATAAACTATCACTGTCATAATAAGTAACTCATTTTATTTA[T/A]
AACATCTTGTTTATATATATATATTTGTCATGGTTACAAACATCTTATTTTTATATATATTTGTCATGGTTACAAATATGGTATACCTCTTATCCTACGA

Reverse complement sequence

TCGTAGGATAAGAGGTATACCATATTTGTAACCATGACAAATATATATAAAAATAAGATGTTTGTAACCATGACAAATATATATATATAAACAAGATGTT[A/T]
TAAATAAAATGAGTTACTTATTATGACAGTGATAGTTTATTTAATAAAAAAATTCTAGTAACAACAATTTTACATGATTGATTTTTTTTATTTTTTTCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.40%	18.50%	0.04%	0.00%	NA
All Indica	2759	99.30%	0.70%	0.04%	0.00%	NA
All Japonica	1512	47.20%	52.70%	0.07%	0.00%	NA
Aus	269	89.20%	10.80%	0.00%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.90%	1.00%	0.13%	0.00%	NA
Temperate Japonica	767	20.30%	79.50%	0.13%	0.00%	NA
Tropical Japonica	504	82.10%	17.90%	0.00%	0.00%	NA
Japonica Intermediate	241	59.80%	40.20%	0.00%	0.00%	NA
VI/Aromatic	96	81.20%	18.80%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0611689492	T -> A	LOC_Os06g20340.1	upstream_gene_variant ; 1577.0bp to feature; MODIFIER	silent_mutation	Average:56.518; most accessible tissue: Callus, score: 85.29	N	N	N	N
vg0611689492	T -> A	LOC_Os06g20354.1	upstream_gene_variant ; 3539.0bp to feature; MODIFIER	silent_mutation	Average:56.518; most accessible tissue: Callus, score: 85.29	N	N	N	N
vg0611689492	T -> A	LOC_Os06g20340.2	upstream_gene_variant ; 3284.0bp to feature; MODIFIER	silent_mutation	Average:56.518; most accessible tissue: Callus, score: 85.29	N	N	N	N
vg0611689492	T -> A	LOC_Os06g20340-LOC_Os06g20354	intergenic_region ; MODIFIER	silent_mutation	Average:56.518; most accessible tissue: Callus, score: 85.29	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0611689492	NA	2.59E-07	mr1091	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492	NA	4.45E-13	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492	NA	1.48E-07	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492	NA	1.56E-07	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492	NA	5.12E-08	mr1094_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492	NA	2.20E-08	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492	NA	4.76E-07	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492	NA	5.94E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492	NA	1.87E-07	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492	NA	9.74E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492	4.60E-06	4.60E-06	mr1234_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492	NA	7.37E-07	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492	NA	1.59E-06	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492	NA	2.10E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492	NA	6.19E-08	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492	NA	7.68E-06	mr1763_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611689492	NA	5.37E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251