\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611683955:

Variant ID: vg0611683955 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11683955
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATGAGGTATGTTTCTTGGCTTCAGAGGATATCCGTATCAGTCGGAAATCCTAACACCATATTCTTTTTCGTATCCTGGAGAAAATATTTATATTTTTC[A/G]
TATCCTGGAGAAAATATTTATATTTGTATCCGTATCCAAACTATCCGCTCAAAAAGTATCCGTATTTGTTTTTCTCCTGAGCTGATGGAAATTATCCGCT

Reverse complement sequence

AGCGGATAATTTCCATCAGCTCAGGAGAAAAACAAATACGGATACTTTTTGAGCGGATAGTTTGGATACGGATACAAATATAAATATTTTCTCCAGGATA[T/C]
GAAAAATATAAATATTTTCTCCAGGATACGAAAAAGAATATGGTGTTAGGATTTCCGACTGATACGGATATCCTCTGAAGCCAAGAAACATACCTCATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.00% 19.80% 0.17% 0.00% NA
All Indica  2759 99.20% 0.80% 0.04% 0.00% NA
All Japonica  1512 43.20% 56.30% 0.46% 0.00% NA
Aus  269 89.20% 10.80% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.10% 0.13% 0.00% NA
Temperate Japonica  767 17.10% 82.10% 0.78% 0.00% NA
Tropical Japonica  504 76.20% 23.80% 0.00% 0.00% NA
Japonica Intermediate  241 57.30% 42.30% 0.41% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611683955 A -> G LOC_Os06g20330.1 upstream_gene_variant ; 750.0bp to feature; MODIFIER silent_mutation Average:74.752; most accessible tissue: Callus, score: 89.185 N N N N
vg0611683955 A -> G LOC_Os06g20320.1 downstream_gene_variant ; 1863.0bp to feature; MODIFIER silent_mutation Average:74.752; most accessible tissue: Callus, score: 89.185 N N N N
vg0611683955 A -> G LOC_Os06g20340.1 downstream_gene_variant ; 225.0bp to feature; MODIFIER silent_mutation Average:74.752; most accessible tissue: Callus, score: 89.185 N N N N
vg0611683955 A -> G LOC_Os06g20340.2 downstream_gene_variant ; 225.0bp to feature; MODIFIER silent_mutation Average:74.752; most accessible tissue: Callus, score: 89.185 N N N N
vg0611683955 A -> G LOC_Os06g20330-LOC_Os06g20340 intergenic_region ; MODIFIER silent_mutation Average:74.752; most accessible tissue: Callus, score: 89.185 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611683955 NA 4.45E-07 mr1091 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611683955 9.65E-06 9.65E-06 mr1065_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611683955 NA 3.33E-06 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611683955 NA 4.72E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611683955 NA 7.40E-11 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611683955 NA 1.09E-08 mr1091_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611683955 NA 1.77E-07 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611683955 NA 2.88E-08 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611683955 3.92E-06 3.92E-06 mr1108_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611683955 NA 1.17E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611683955 NA 5.03E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611683955 NA 2.55E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611683955 NA 8.55E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611683955 NA 9.38E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611683955 9.39E-07 9.38E-07 mr1234_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611683955 NA 1.26E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611683955 NA 1.63E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611683955 NA 3.47E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611683955 NA 3.24E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611683955 NA 4.51E-08 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611683955 NA 1.66E-06 mr1763_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251