Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611650489:

Variant ID: vg0611650489 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 11650489
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.30, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

CTCTGGAAGTAAACACTTAAGTGGAGGGTAATATTACTTGGTTGATTAATGACAGCCACTGCAAGGTGATTTAGAAGTTAGAACAGATGTCATGTGCTGC[T/C]
CCAAATAAGCCAGTGATATTGTCAGGTACTAAGGTGGGAGTTATTTGAGTTGTGCGCCTGTAGGTATTTAGGTCAATCGTCTCCTCGCCTCAGCCTACCA

Reverse complement sequence

TGGTAGGCTGAGGCGAGGAGACGATTGACCTAAATACCTACAGGCGCACAACTCAAATAACTCCCACCTTAGTACCTGACAATATCACTGGCTTATTTGG[A/G]
GCAGCACATGACATCTGTTCTAACTTCTAAATCACCTTGCAGTGGCTGTCATTAATCAACCAAGTAATATTACCCTCCACTTAAGTGTTTACTTCCAGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.30%	21.60%	0.08%	0.00%	NA
All Indica	2759	90.60%	9.30%	0.11%	0.00%	NA
All Japonica	1512	53.80%	46.20%	0.07%	0.00%	NA
Aus	269	88.80%	11.20%	0.00%	0.00%	NA
Indica I	595	90.90%	8.70%	0.34%	0.00%	NA
Indica II	465	91.60%	8.40%	0.00%	0.00%	NA
Indica III	913	90.60%	9.30%	0.11%	0.00%	NA
Indica Intermediate	786	89.70%	10.30%	0.00%	0.00%	NA
Temperate Japonica	767	32.20%	67.70%	0.13%	0.00%	NA
Tropical Japonica	504	81.00%	19.00%	0.00%	0.00%	NA
Japonica Intermediate	241	65.60%	34.40%	0.00%	0.00%	NA
VI/Aromatic	96	77.10%	22.90%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0611650489	T -> C	LOC_Os06g20290.1	downstream_gene_variant ; 3333.0bp to feature; MODIFIER	silent_mutation	Average:40.709; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0611650489	T -> C	LOC_Os06g20280-LOC_Os06g20290	intergenic_region ; MODIFIER	silent_mutation	Average:40.709; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0611650489	NA	3.00E-07	mr1695	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611650489	2.97E-09	NA	mr1065_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611650489	7.38E-09	NA	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611650489	1.56E-06	NA	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611650489	4.14E-08	NA	mr1087_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611650489	8.69E-12	NA	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611650489	1.47E-07	NA	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611650489	2.24E-09	NA	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611650489	1.95E-07	NA	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611650489	1.22E-08	NA	mr1108_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611650489	2.11E-08	NA	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611650489	4.87E-09	NA	mr1112_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611650489	3.53E-07	NA	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611650489	1.51E-06	NA	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611650489	9.66E-06	NA	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611650489	6.28E-09	NA	mr1234_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611650489	3.73E-08	NA	mr1526_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611650489	9.28E-07	1.57E-07	mr1695_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251