\
| Variant ID: vg0611645542 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11645542 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 277. )
GCACTATATTTTTTTGTCACTTTGTATATTGCCCGATCCGCCACCTTGATACGTTTCCTGCTTCAATTGATTAAAAAATCGATTCCCTACCCCTTTTGAT[T/C]
TGGCTTTAATTTTCCCGGATTTAATCTCCAGCCGCCGCCTAGGCCGACCCCTAACGCCGCCGCCACATCGATCTACCTCCCCGTGCGTTTTCTCTTTTCG
CGAAAAGAGAAAACGCACGGGGAGGTAGATCGATGTGGCGGCGGCGTTAGGGGTCGGCCTAGGCGGCGGCTGGAGATTAAATCCGGGAAAATTAAAGCCA[A/G]
ATCAAAAGGGGTAGGGAATCGATTTTTTAATCAATTGAAGCAGGAAACGTATCAAGGTGGCGGATCGGGCAATATACAAAGTGACAAAAAAATATAGTGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.40% | 4.00% | 0.57% | 0.00% | NA |
| All Indica | 2759 | 92.80% | 6.30% | 0.98% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.70% | 6.50% | 0.86% | 0.00% | NA |
| Indica III | 913 | 88.30% | 9.60% | 2.08% | 0.00% | NA |
| Indica Intermediate | 786 | 92.50% | 7.00% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611645542 | T -> C | LOC_Os06g20280.1 | upstream_gene_variant ; 2228.0bp to feature; MODIFIER | silent_mutation | Average:32.658; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0611645542 | T -> C | LOC_Os06g20280-LOC_Os06g20290 | intergenic_region ; MODIFIER | silent_mutation | Average:32.658; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611645542 | 2.02E-06 | NA | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611645542 | 7.90E-08 | 4.30E-09 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611645542 | 3.09E-06 | 1.40E-06 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611645542 | 1.89E-06 | NA | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611645542 | 1.61E-07 | 6.07E-08 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611645542 | 1.55E-06 | NA | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611645542 | 2.22E-08 | 3.24E-09 | mr1211 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611645542 | 4.41E-07 | NA | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611645542 | 5.74E-09 | 5.19E-10 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611645542 | NA | 2.49E-06 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611645542 | 4.93E-06 | NA | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611645542 | 9.82E-07 | 8.75E-08 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611645542 | 1.05E-08 | 2.90E-10 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |