\
| Variant ID: vg0611643367 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11643367 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 245. )
GTCCGAATCCATCCCGCGCGAATCCTCTCCCTGTTTGATCCTCTCCATTGTTCCTGATAGTTGAATTGACGTGCACGAGCGCGGGTAATAGGACCATGAA[G/A]
TTGTACTTGTGGAGGCGTGGATGTATCGTTGGTGTTGTTGATGTCCTCATCAGTATTTTGGCCATAAAATTTCACAAATATAGTTTTTGACTTTAATTTA
TAAATTAAAGTCAAAAACTATATTTGTGAAATTTTATGGCCAAAATACTGATGAGGACATCAACAACACCAACGATACATCCACGCCTCCACAAGTACAA[C/T]
TTCATGGTCCTATTACCCGCGCTCGTGCACGTCAATTCAACTATCAGGAACAATGGAGAGGATCAAACAGGGAGAGGATTCGCGCGGGATGGATTCGGAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.40% | 45.90% | 0.72% | 0.00% | NA |
| All Indica | 2759 | 87.30% | 11.60% | 1.12% | 0.00% | NA |
| All Japonica | 1512 | 3.60% | 96.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 6.30% | 93.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.20% | 10.40% | 0.34% | 0.00% | NA |
| Indica II | 465 | 89.00% | 10.30% | 0.65% | 0.00% | NA |
| Indica III | 913 | 87.70% | 10.30% | 1.97% | 0.00% | NA |
| Indica Intermediate | 786 | 84.40% | 14.60% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 3.00% | 96.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 4.80% | 95.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 51.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611643367 | G -> A | LOC_Os06g20280.1 | upstream_gene_variant ; 53.0bp to feature; MODIFIER | silent_mutation | Average:50.538; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0611643367 | G -> A | LOC_Os06g20280-LOC_Os06g20290 | intergenic_region ; MODIFIER | silent_mutation | Average:50.538; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611643367 | NA | 4.46E-07 | mr1033 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 6.81E-07 | 9.72E-61 | mr1065 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 1.78E-06 | NA | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | NA | 1.07E-46 | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 7.15E-08 | 1.10E-60 | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 7.36E-08 | 7.15E-09 | mr1068 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | NA | 7.60E-52 | mr1078 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 9.64E-09 | 1.68E-62 | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 8.30E-09 | 2.02E-10 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 4.43E-06 | 2.54E-56 | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 3.71E-07 | 6.63E-07 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 4.37E-08 | 3.82E-44 | mr1091 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 3.91E-06 | NA | mr1091 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | NA | 1.29E-39 | mr1094 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 1.61E-07 | 8.58E-57 | mr1096 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 3.14E-06 | 1.20E-06 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 3.58E-07 | 2.94E-52 | mr1108 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 4.23E-06 | NA | mr1108 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | NA | 1.52E-40 | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 6.69E-07 | 4.70E-53 | mr1111 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 1.19E-06 | 1.40E-06 | mr1111 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 1.72E-06 | 4.23E-51 | mr1112 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 5.55E-06 | 1.01E-51 | mr1121 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 8.60E-08 | 6.41E-52 | mr1144 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 8.74E-07 | 3.10E-07 | mr1144 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 3.52E-06 | 9.79E-47 | mr1200 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 3.10E-06 | 1.81E-06 | mr1200 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | NA | 3.61E-49 | mr1211 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | NA | 8.65E-31 | mr1221 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 2.21E-06 | 2.85E-50 | mr1234 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 7.13E-06 | NA | mr1234 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | NA | 4.53E-34 | mr1237 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | NA | 4.09E-20 | mr1244 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | NA | 2.12E-42 | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | NA | 1.21E-09 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 9.78E-07 | 1.03E-49 | mr1526 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 1.73E-06 | 6.26E-09 | mr1526 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | NA | 3.66E-13 | mr1655 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | NA | 3.94E-07 | mr1695 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | NA | 4.59E-07 | mr1717 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | NA | 1.56E-08 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | NA | 5.28E-26 | mr1877 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 1.06E-07 | 9.41E-70 | mr1065_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 3.74E-11 | 7.95E-11 | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 9.72E-07 | 1.01E-56 | mr1067_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 2.64E-07 | NA | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 7.49E-09 | 2.09E-73 | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 8.86E-12 | 1.82E-11 | mr1068_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 4.27E-06 | 9.51E-65 | mr1078_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 2.01E-08 | NA | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 6.03E-09 | 1.39E-71 | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 1.32E-13 | 5.75E-13 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 1.71E-06 | 5.54E-63 | mr1090_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 1.70E-09 | 8.74E-08 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 4.27E-09 | 2.08E-56 | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 2.19E-10 | NA | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 5.17E-06 | 1.65E-49 | mr1094_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 6.74E-07 | NA | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 2.82E-06 | 1.02E-63 | mr1096_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 5.02E-09 | 9.21E-08 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 1.20E-08 | 2.41E-62 | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 2.19E-11 | 7.50E-10 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 3.28E-06 | 2.62E-44 | mr1110_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 8.27E-07 | 1.63E-06 | mr1110_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 3.09E-09 | 1.04E-60 | mr1111_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 2.00E-14 | 3.24E-12 | mr1111_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 1.25E-08 | 3.96E-70 | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 7.99E-12 | 2.34E-11 | mr1112_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 1.69E-06 | 2.25E-56 | mr1121_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 9.67E-10 | 2.52E-08 | mr1121_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 9.75E-07 | 8.43E-58 | mr1144_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 1.27E-09 | 1.95E-08 | mr1144_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 4.14E-06 | NA | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 7.55E-06 | 5.51E-57 | mr1211_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 6.47E-08 | 1.15E-07 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | NA | 6.17E-36 | mr1221_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 5.40E-08 | 3.68E-64 | mr1234_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 3.40E-11 | NA | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | NA | 9.48E-25 | mr1244_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | NA | 1.57E-50 | mr1458_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 3.56E-07 | 5.24E-60 | mr1526_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 2.37E-09 | 1.34E-09 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | NA | 7.78E-08 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | 7.96E-06 | 3.55E-06 | mr1695_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611643367 | NA | 9.91E-23 | mr1877_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |