\
| Variant ID: vg0611636429 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11636429 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.73, T: 0.27, others allele: 0.00, population size: 96. )
AGTAATTGAGCTCTGAAAATTCCGATAAAATTCCAGAGAGTATAATTAATTATGGAGAATTTAATAGAAATTAAATCTAGCCGTGCTTTTATATTTATAA[A/T]
ATTTTATTTCCCATATTTAACTTCACTTGTAAATTAATAAACATTTAATATAAATTCTAAAAATAATTTATTAAATAATTTATAAGTACTGAAACGAAAA
TTTTCGTTTCAGTACTTATAAATTATTTAATAAATTATTTTTAGAATTTATATTAAATGTTTATTAATTTACAAGTGAAGTTAAATATGGGAAATAAAAT[T/A]
TTATAAATATAAAAGCACGGCTAGATTTAATTTCTATTAAATTCTCCATAATTAATTATACTCTCTGGAATTTTATCGGAATTTTCAGAGCTCAATTACT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.60% | 21.00% | 5.44% | 4.04% | NA |
| All Indica | 2759 | 81.50% | 9.10% | 4.71% | 4.71% | NA |
| All Japonica | 1512 | 52.10% | 36.00% | 8.20% | 3.70% | NA |
| Aus | 269 | 69.50% | 30.10% | 0.00% | 0.37% | NA |
| Indica I | 595 | 76.50% | 7.70% | 12.10% | 3.70% | NA |
| Indica II | 465 | 75.70% | 7.50% | 6.24% | 10.54% | NA |
| Indica III | 913 | 87.60% | 9.60% | 0.44% | 2.30% | NA |
| Indica Intermediate | 786 | 81.70% | 10.30% | 3.18% | 4.83% | NA |
| Temperate Japonica | 767 | 30.00% | 49.70% | 14.21% | 6.13% | NA |
| Tropical Japonica | 504 | 81.00% | 16.50% | 1.59% | 0.99% | NA |
| Japonica Intermediate | 241 | 61.80% | 33.60% | 2.90% | 1.66% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 25.60% | 3.33% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611636429 | A -> T | LOC_Os06g20280.1 | downstream_gene_variant ; 861.0bp to feature; MODIFIER | silent_mutation | Average:52.272; most accessible tissue: Callus, score: 80.467 | N | N | N | N |
| vg0611636429 | A -> T | LOC_Os06g20270-LOC_Os06g20280 | intergenic_region ; MODIFIER | silent_mutation | Average:52.272; most accessible tissue: Callus, score: 80.467 | N | N | N | N |
| vg0611636429 | A -> DEL | N | N | silent_mutation | Average:52.272; most accessible tissue: Callus, score: 80.467 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611636429 | NA | 4.89E-08 | mr1695 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | 3.00E-08 | NA | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | 1.40E-07 | NA | mr1067_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | 4.12E-08 | NA | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | 4.31E-06 | NA | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | 3.76E-07 | NA | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | 7.12E-11 | 4.78E-10 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | 4.09E-06 | NA | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | 4.21E-06 | NA | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | 2.71E-07 | NA | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | NA | 2.06E-06 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | 2.19E-07 | NA | mr1108_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | 6.33E-09 | NA | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | 2.33E-06 | NA | mr1111_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | 4.50E-09 | 4.11E-07 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | 1.28E-06 | NA | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | 3.90E-09 | NA | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | 5.37E-07 | 2.87E-06 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | 8.30E-07 | NA | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | 1.37E-06 | NA | mr1234_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | 2.67E-09 | NA | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | 3.41E-09 | 5.09E-08 | mr1526_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611636429 | NA | 4.21E-06 | mr1695_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |