\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611590585:

Variant ID: vg0611590585 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11590585
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAAAAGGAGCCTCCACGTTCGTTGTCATTGCCTAGAAATTCTCACATTAATCGGAGAAAAAGAAAAGGCAGAATCCATATAGAAATATAATTTAGAAA[C/T]
AGCTGAAATTCGGAATTAAAAAATAAGGAATATTAGAAGAGGAGACTAGAGTACATATAGAAATATAATTTAGAAATAGTTGAAATTCGGAATTAAAAAA

Reverse complement sequence

TTTTTTAATTCCGAATTTCAACTATTTCTAAATTATATTTCTATATGTACTCTAGTCTCCTCTTCTAATATTCCTTATTTTTTAATTCCGAATTTCAGCT[G/A]
TTTCTAAATTATATTTCTATATGGATTCTGCCTTTTCTTTTTCTCCGATTAATGTGAGAATTTCTAGGCAATGACAACGAACGTGGAGGCTCCTTTTTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.30% 0.30% 37.98% 20.40% NA
All Indica  2759 7.80% 0.60% 60.49% 31.10% NA
All Japonica  1512 92.50% 0.00% 1.72% 5.75% NA
Aus  269 74.70% 0.00% 24.16% 1.12% NA
Indica I  595 9.20% 1.20% 34.29% 55.29% NA
Indica II  465 4.50% 0.40% 43.87% 51.18% NA
Indica III  913 3.60% 0.30% 87.84% 8.21% NA
Indica Intermediate  786 13.60% 0.50% 58.40% 27.48% NA
Temperate Japonica  767 97.00% 0.00% 1.83% 1.17% NA
Tropical Japonica  504 83.70% 0.00% 1.59% 14.68% NA
Japonica Intermediate  241 96.70% 0.00% 1.66% 1.66% NA
VI/Aromatic  96 93.80% 0.00% 6.25% 0.00% NA
Intermediate  90 50.00% 0.00% 32.22% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611590585 C -> T LOC_Os06g20210.1 upstream_gene_variant ; 3492.0bp to feature; MODIFIER silent_mutation Average:16.025; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0611590585 C -> T LOC_Os06g20200.1 downstream_gene_variant ; 2506.0bp to feature; MODIFIER silent_mutation Average:16.025; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0611590585 C -> T LOC_Os06g20200-LOC_Os06g20210 intergenic_region ; MODIFIER silent_mutation Average:16.025; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0611590585 C -> DEL N N silent_mutation Average:16.025; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611590585 NA 5.16E-14 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 2.46E-07 2.46E-07 mr1032 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 1.31E-60 mr1065 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 2.53E-46 mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 3.45E-07 1.21E-60 mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 8.56E-06 NA mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 2.61E-06 5.30E-57 mr1078 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 2.51E-06 6.78E-64 mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 7.79E-07 4.78E-63 mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 8.70E-36 mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 2.28E-44 mr1108 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 2.30E-35 mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 1.15E-49 mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 1.64E-48 mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 9.48E-48 mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 7.30E-16 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 4.30E-07 4.30E-07 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 5.17E-46 mr1200 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 2.10E-07 6.78E-61 mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 2.48E-28 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 7.47E-46 mr1234 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 3.71E-14 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 4.34E-09 4.34E-09 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 1.66E-46 mr1526 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 1.19E-20 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 4.41E-08 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 1.33E-65 mr1065_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 2.00E-10 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 2.33E-58 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 2.25E-06 3.69E-75 mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 9.17E-06 6.23E-10 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 9.11E-70 mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 8.54E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 7.14E-06 2.59E-77 mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 4.36E-06 1.87E-10 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 3.72E-06 6.42E-72 mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 6.33E-06 1.06E-06 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 1.42E-44 mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 3.22E-60 mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 9.51E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 1.46E-56 mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 3.75E-11 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 9.59E-38 mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 3.25E-07 1.00E-59 mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 1.92E-12 2.40E-13 mr1111_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 1.22E-60 mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 9.88E-09 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 9.38E-53 mr1121_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 2.51E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 6.09E-58 mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 3.51E-07 8.82E-10 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 9.85E-21 mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 2.43E-07 1.52E-10 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 1.35E-58 mr1200_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 8.11E-09 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 9.53E-08 1.28E-68 mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 1.08E-06 3.88E-08 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 7.46E-59 mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 1.79E-10 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 1.40E-06 1.40E-06 mr1477_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 2.34E-59 mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 6.42E-17 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 5.48E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590585 NA 3.48E-23 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251