\
| Variant ID: vg0611590484 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11590484 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GACTTGTATAGGTATATAGGATACAATTAGGAAATAACTGAAATTCGGAATTAAAAATATAGAATATTAGAAATAGAGAATATATATATTATTAAATGAA[T/C]
ATAAAAAGGAGCCTCCACGTTCGTTGTCATTGCCTAGAAATTCTCACATTAATCGGAGAAAAAGAAAAGGCAGAATCCATATAGAAATATAATTTAGAAA
TTTCTAAATTATATTTCTATATGGATTCTGCCTTTTCTTTTTCTCCGATTAATGTGAGAATTTCTAGGCAATGACAACGAACGTGGAGGCTCCTTTTTAT[A/G]
TTCATTTAATAATATATATATTCTCTATTTCTAATATTCTATATTTTTAATTCCGAATTTCAGTTATTTCCTAATTGTATCCTATATACCTATACAAGTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.30% | 0.30% | 1.40% | 0.00% | NA |
| All Indica | 2759 | 97.10% | 0.60% | 2.36% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.60% | 0.20% | 5.16% | 0.00% | NA |
| Indica III | 913 | 95.70% | 1.30% | 2.96% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 0.40% | 1.78% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611590484 | T -> C | LOC_Os06g20210.1 | upstream_gene_variant ; 3593.0bp to feature; MODIFIER | silent_mutation | Average:20.505; most accessible tissue: Callus, score: 83.475 | N | N | N | N |
| vg0611590484 | T -> C | LOC_Os06g20200.1 | downstream_gene_variant ; 2405.0bp to feature; MODIFIER | silent_mutation | Average:20.505; most accessible tissue: Callus, score: 83.475 | N | N | N | N |
| vg0611590484 | T -> C | LOC_Os06g20200-LOC_Os06g20210 | intergenic_region ; MODIFIER | silent_mutation | Average:20.505; most accessible tissue: Callus, score: 83.475 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611590484 | NA | 1.63E-06 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611590484 | NA | 5.30E-07 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611590484 | NA | 3.11E-06 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611590484 | NA | 6.53E-06 | mr1695 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611590484 | NA | 2.01E-06 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611590484 | NA | 1.99E-06 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611590484 | 3.36E-06 | 1.24E-08 | mr1110_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611590484 | NA | 3.92E-06 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611590484 | NA | 9.23E-09 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611590484 | NA | 9.46E-06 | mr1695_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |