Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611590484:

Variant ID: vg0611590484 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 11590484
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACTTGTATAGGTATATAGGATACAATTAGGAAATAACTGAAATTCGGAATTAAAAATATAGAATATTAGAAATAGAGAATATATATATTATTAAATGAA[T/C]
ATAAAAAGGAGCCTCCACGTTCGTTGTCATTGCCTAGAAATTCTCACATTAATCGGAGAAAAAGAAAAGGCAGAATCCATATAGAAATATAATTTAGAAA

Reverse complement sequence

TTTCTAAATTATATTTCTATATGGATTCTGCCTTTTCTTTTTCTCCGATTAATGTGAGAATTTCTAGGCAATGACAACGAACGTGGAGGCTCCTTTTTAT[A/G]
TTCATTTAATAATATATATATTCTCTATTTCTAATATTCTATATTTTTAATTCCGAATTTCAGTTATTTCCTAATTGTATCCTATATACCTATACAAGTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.30%	0.30%	1.40%	0.00%	NA
All Indica	2759	97.10%	0.60%	2.36%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	94.60%	0.20%	5.16%	0.00%	NA
Indica III	913	95.70%	1.30%	2.96%	0.00%	NA
Indica Intermediate	786	97.80%	0.40%	1.78%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0611590484	T -> C	LOC_Os06g20210.1	upstream_gene_variant ; 3593.0bp to feature; MODIFIER	silent_mutation	Average:20.505; most accessible tissue: Callus, score: 83.475	N	N	N	N
vg0611590484	T -> C	LOC_Os06g20200.1	downstream_gene_variant ; 2405.0bp to feature; MODIFIER	silent_mutation	Average:20.505; most accessible tissue: Callus, score: 83.475	N	N	N	N
vg0611590484	T -> C	LOC_Os06g20200-LOC_Os06g20210	intergenic_region ; MODIFIER	silent_mutation	Average:20.505; most accessible tissue: Callus, score: 83.475	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0611590484	NA	1.63E-06	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590484	NA	5.30E-07	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590484	NA	3.11E-06	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590484	NA	6.53E-06	mr1695	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590484	NA	2.01E-06	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590484	NA	1.99E-06	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590484	3.36E-06	1.24E-08	mr1110_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590484	NA	3.92E-06	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590484	NA	9.23E-09	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590484	NA	9.46E-06	mr1695_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251