\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611590484:

Variant ID: vg0611590484 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11590484
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACTTGTATAGGTATATAGGATACAATTAGGAAATAACTGAAATTCGGAATTAAAAATATAGAATATTAGAAATAGAGAATATATATATTATTAAATGAA[T/C]
ATAAAAAGGAGCCTCCACGTTCGTTGTCATTGCCTAGAAATTCTCACATTAATCGGAGAAAAAGAAAAGGCAGAATCCATATAGAAATATAATTTAGAAA

Reverse complement sequence

TTTCTAAATTATATTTCTATATGGATTCTGCCTTTTCTTTTTCTCCGATTAATGTGAGAATTTCTAGGCAATGACAACGAACGTGGAGGCTCCTTTTTAT[A/G]
TTCATTTAATAATATATATATTCTCTATTTCTAATATTCTATATTTTTAATTCCGAATTTCAGTTATTTCCTAATTGTATCCTATATACCTATACAAGTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.30% 0.30% 1.40% 0.00% NA
All Indica  2759 97.10% 0.60% 2.36% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 94.60% 0.20% 5.16% 0.00% NA
Indica III  913 95.70% 1.30% 2.96% 0.00% NA
Indica Intermediate  786 97.80% 0.40% 1.78% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611590484 T -> C LOC_Os06g20210.1 upstream_gene_variant ; 3593.0bp to feature; MODIFIER silent_mutation Average:20.505; most accessible tissue: Callus, score: 83.475 N N N N
vg0611590484 T -> C LOC_Os06g20200.1 downstream_gene_variant ; 2405.0bp to feature; MODIFIER silent_mutation Average:20.505; most accessible tissue: Callus, score: 83.475 N N N N
vg0611590484 T -> C LOC_Os06g20200-LOC_Os06g20210 intergenic_region ; MODIFIER silent_mutation Average:20.505; most accessible tissue: Callus, score: 83.475 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611590484 NA 1.63E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590484 NA 5.30E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590484 NA 3.11E-06 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590484 NA 6.53E-06 mr1695 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590484 NA 2.01E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590484 NA 1.99E-06 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590484 3.36E-06 1.24E-08 mr1110_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590484 NA 3.92E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590484 NA 9.23E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611590484 NA 9.46E-06 mr1695_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251