Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611588314:

Variant ID: vg0611588314 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11588314
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACCATCTATCTATTATATTATTAATGGAATAGAAAAAAGAGCCTCCACGTTCGCTCTCATGGCCTAGAAATTCTCACATTAATCGAAGAAAAAGAAAAA[A/G]
TATAGTCCATATAGAAATACAATTTAGAAATAGCTGAAATTCGAAATTAAAAAATAAGGAATATTAGAAGAGGAGACTAAAGTCCATATCGAAATACAAT

Reverse complement sequence

ATTGTATTTCGATATGGACTTTAGTCTCCTCTTCTAATATTCCTTATTTTTTAATTTCGAATTTCAGCTATTTCTAAATTGTATTTCTATATGGACTATA[T/C]
TTTTTCTTTTTCTTCGATTAATGTGAGAATTTCTAGGCCATGAGAGCGAACGTGGAGGCTCTTTTTTCTATTCCATTAATAATATAATAGATAGATGGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.50% 43.00% 3.26% 1.29% NA
All Indica  2759 82.10% 10.50% 5.11% 2.21% NA
All Japonica  1512 6.70% 92.80% 0.46% 0.00% NA
Aus  269 25.30% 74.30% 0.37% 0.00% NA
Indica I  595 80.80% 9.40% 4.54% 5.21% NA
Indica II  465 84.90% 8.20% 6.67% 0.22% NA
Indica III  913 86.30% 8.00% 4.93% 0.77% NA
Indica Intermediate  786 76.60% 15.80% 4.83% 2.80% NA
Temperate Japonica  767 2.50% 97.10% 0.39% 0.00% NA
Tropical Japonica  504 15.30% 84.30% 0.40% 0.00% NA
Japonica Intermediate  241 2.50% 96.70% 0.83% 0.00% NA
VI/Aromatic  96 5.20% 93.80% 1.04% 0.00% NA
Intermediate  90 43.30% 52.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611588314 A -> G LOC_Os06g20190.1 downstream_gene_variant ; 3882.0bp to feature; MODIFIER silent_mutation Average:26.263; most accessible tissue: Callus, score: 61.17 N N N N
vg0611588314 A -> G LOC_Os06g20200.1 downstream_gene_variant ; 235.0bp to feature; MODIFIER silent_mutation Average:26.263; most accessible tissue: Callus, score: 61.17 N N N N
vg0611588314 A -> G LOC_Os06g20200-LOC_Os06g20210 intergenic_region ; MODIFIER silent_mutation Average:26.263; most accessible tissue: Callus, score: 61.17 N N N N
vg0611588314 A -> DEL N N silent_mutation Average:26.263; most accessible tissue: Callus, score: 61.17 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611588314 NA 3.23E-07 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 1.48E-57 mr1065 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 7.97E-44 mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 8.32E-57 mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 7.22E-54 mr1078 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 6.89E-60 mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 2.52E-59 mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 1.36E-45 mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 2.09E-43 mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 1.41E-44 mr1200 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 3.53E-56 mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 3.47E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 2.77E-46 mr1526 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 2.39E-06 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 2.12E-06 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 7.70E-63 mr1065_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 4.45E-06 NA mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 1.79E-70 mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 3.83E-08 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 5.92E-64 mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 2.67E-72 mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 4.81E-07 1.89E-09 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 4.64E-67 mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 2.60E-06 NA mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 7.06E-55 mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 9.17E-06 4.51E-09 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 1.91E-53 mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 2.97E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 1.04E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 2.10E-54 mr1200_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 9.73E-07 NA mr1200_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 2.89E-06 2.76E-64 mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 1.28E-06 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 2.91E-06 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 1.42E-08 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 4.42E-14 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 2.57E-17 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 1.76E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611588314 NA 1.23E-21 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251