\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611577935:

Variant ID: vg0611577935 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11577935
Reference Allele: TAlternative Allele: G,C
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.81, G: 0.18, C: 0.01, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TTTATATTGCTATAATATATCTTAGTAGATTGATTTATTTTAATACGAATGGAGTACATCATATAACATGGAGTATATCTGAGAGCGTGAAATTGCCCCT[T/G,C]
GCTGAATAATAATGGTCGCGGTCAGTCATGCGAAGTAGTTCTACCCCGTAAACGTACACGAGACTACGAGAGCGAATCCAACAAGACTTAGCAAGAGATT

Reverse complement sequence

AATCTCTTGCTAAGTCTTGTTGGATTCGCTCTCGTAGTCTCGTGTACGTTTACGGGGTAGAACTACTTCGCATGACTGACCGCGACCATTATTATTCAGC[A/C,G]
AGGGGCAATTTCACGCTCTCAGATATACTCCATGTTATATGATGTACTCCATTCGTATTAAAATAAATCAATCTACTAAGATATATTATAGCAATATAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.10% 39.30% 0.06% 0.00% C: 0.55%
All Indica  2759 92.00% 7.10% 0.07% 0.00% C: 0.91%
All Japonica  1512 7.40% 92.50% 0.07% 0.00% C: 0.07%
Aus  269 27.10% 72.90% 0.00% 0.00% NA
Indica I  595 87.70% 12.30% 0.00% 0.00% NA
Indica II  465 95.70% 3.90% 0.00% 0.00% C: 0.43%
Indica III  913 96.50% 1.60% 0.11% 0.00% C: 1.75%
Indica Intermediate  786 87.70% 11.30% 0.13% 0.00% C: 0.89%
Temperate Japonica  767 3.00% 96.90% 0.13% 0.00% NA
Tropical Japonica  504 16.10% 83.70% 0.00% 0.00% C: 0.20%
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 68.80% 31.20% 0.00% 0.00% NA
Intermediate  90 55.60% 44.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611577935 T -> C LOC_Os06g20170.1 upstream_gene_variant ; 4530.0bp to feature; MODIFIER silent_mutation Average:67.25; most accessible tissue: Callus, score: 91.762 N N N N
vg0611577935 T -> C LOC_Os06g20190.1 upstream_gene_variant ; 3256.0bp to feature; MODIFIER silent_mutation Average:67.25; most accessible tissue: Callus, score: 91.762 N N N N
vg0611577935 T -> C LOC_Os06g20180.1 downstream_gene_variant ; 341.0bp to feature; MODIFIER silent_mutation Average:67.25; most accessible tissue: Callus, score: 91.762 N N N N
vg0611577935 T -> C LOC_Os06g20180-LOC_Os06g20190 intergenic_region ; MODIFIER silent_mutation Average:67.25; most accessible tissue: Callus, score: 91.762 N N N N
vg0611577935 T -> G LOC_Os06g20170.1 upstream_gene_variant ; 4530.0bp to feature; MODIFIER silent_mutation Average:67.25; most accessible tissue: Callus, score: 91.762 N N N N
vg0611577935 T -> G LOC_Os06g20190.1 upstream_gene_variant ; 3256.0bp to feature; MODIFIER silent_mutation Average:67.25; most accessible tissue: Callus, score: 91.762 N N N N
vg0611577935 T -> G LOC_Os06g20180.1 downstream_gene_variant ; 341.0bp to feature; MODIFIER silent_mutation Average:67.25; most accessible tissue: Callus, score: 91.762 N N N N
vg0611577935 T -> G LOC_Os06g20180-LOC_Os06g20190 intergenic_region ; MODIFIER silent_mutation Average:67.25; most accessible tissue: Callus, score: 91.762 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611577935 2.46E-07 2.46E-07 mr1032 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 4.30E-08 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 3.64E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 1.23E-06 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 6.28E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 4.41E-17 mr1138 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 3.58E-07 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 4.30E-07 4.30E-07 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 3.70E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 4.12E-06 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 2.19E-26 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 1.19E-49 mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 8.69E-09 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 4.09E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 4.34E-09 4.34E-09 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 2.69E-11 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 5.36E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 1.24E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 5.00E-06 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 6.94E-06 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 3.23E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 4.38E-12 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 2.83E-06 9.35E-09 mr1860 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 4.41E-08 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 5.50E-13 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 2.43E-07 1.52E-10 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 2.13E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 1.40E-06 1.40E-06 mr1477_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 6.08E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611577935 NA 4.50E-22 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251