\
| Variant ID: vg0611571279 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11571279 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGCGACTTTGAGGTCGCCATGGACGGTGATGGGGCCACCGGGGCCCGGCATCTTCATCTGGATATAGGCGTACTGGACCGCCGCCATGAACTTCACCAAC[G/A]
CGGGCCTCCCCAGGACCGCGTTGTAGGGCAGACTGAGGTCCGCCACATCGAAGTCCACCCGCTCCGTGCGGAAGTTGGCGGAACCACCAAAGGTGACCGG
CCGGTCACCTTTGGTGGTTCCGCCAACTTCCGCACGGAGCGGGTGGACTTCGATGTGGCGGACCTCAGTCTGCCCTACAACGCGGTCCTGGGGAGGCCCG[C/T]
GTTGGTGAAGTTCATGGCGGCGGTCCAGTACGCCTATATCCAGATGAAGATGCCGGGCCCCGGTGGCCCCATCACCGTCCATGGCGACCTCAAAGTCGCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.70% | 1.20% | 1.06% | 60.03% | NA |
| All Indica | 2759 | 6.60% | 0.00% | 1.01% | 92.39% | NA |
| All Japonica | 1512 | 88.00% | 3.90% | 1.26% | 6.88% | NA |
| Aus | 269 | 73.60% | 0.00% | 0.74% | 25.65% | NA |
| Indica I | 595 | 9.70% | 0.00% | 0.34% | 89.92% | NA |
| Indica II | 465 | 5.20% | 0.00% | 1.08% | 93.76% | NA |
| Indica III | 913 | 1.50% | 0.00% | 1.20% | 97.26% | NA |
| Indica Intermediate | 786 | 10.90% | 0.00% | 1.27% | 87.79% | NA |
| Temperate Japonica | 767 | 89.40% | 6.00% | 1.69% | 2.87% | NA |
| Tropical Japonica | 504 | 83.50% | 0.60% | 1.19% | 14.68% | NA |
| Japonica Intermediate | 241 | 92.50% | 4.10% | 0.00% | 3.32% | NA |
| VI/Aromatic | 96 | 31.20% | 0.00% | 0.00% | 68.75% | NA |
| Intermediate | 90 | 44.40% | 0.00% | 1.11% | 54.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611571279 | G -> A | LOC_Os06g20170.1 | missense_variant ; p.Ala631Val; MODERATE | nonsynonymous_codon ; A631V | Average:7.922; most accessible tissue: Minghui63 panicle, score: 16.27 | benign |
0.491 |
DELETERIOUS | 0.01 |
| vg0611571279 | G -> DEL | LOC_Os06g20170.1 | N | frameshift_variant | Average:7.922; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611571279 | NA | 3.62E-11 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0611571279 | NA | 1.26E-06 | mr1179 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611571279 | NA | 2.31E-06 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611571279 | NA | 7.86E-10 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611571279 | NA | 1.86E-07 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611571279 | NA | 1.59E-08 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611571279 | NA | 1.52E-07 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611571279 | NA | 5.05E-06 | mr1686_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611571279 | NA | 7.49E-07 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |