\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611571279:

Variant ID: vg0611571279 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11571279
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCGACTTTGAGGTCGCCATGGACGGTGATGGGGCCACCGGGGCCCGGCATCTTCATCTGGATATAGGCGTACTGGACCGCCGCCATGAACTTCACCAAC[G/A]
CGGGCCTCCCCAGGACCGCGTTGTAGGGCAGACTGAGGTCCGCCACATCGAAGTCCACCCGCTCCGTGCGGAAGTTGGCGGAACCACCAAAGGTGACCGG

Reverse complement sequence

CCGGTCACCTTTGGTGGTTCCGCCAACTTCCGCACGGAGCGGGTGGACTTCGATGTGGCGGACCTCAGTCTGCCCTACAACGCGGTCCTGGGGAGGCCCG[C/T]
GTTGGTGAAGTTCATGGCGGCGGTCCAGTACGCCTATATCCAGATGAAGATGCCGGGCCCCGGTGGCCCCATCACCGTCCATGGCGACCTCAAAGTCGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.70% 1.20% 1.06% 60.03% NA
All Indica  2759 6.60% 0.00% 1.01% 92.39% NA
All Japonica  1512 88.00% 3.90% 1.26% 6.88% NA
Aus  269 73.60% 0.00% 0.74% 25.65% NA
Indica I  595 9.70% 0.00% 0.34% 89.92% NA
Indica II  465 5.20% 0.00% 1.08% 93.76% NA
Indica III  913 1.50% 0.00% 1.20% 97.26% NA
Indica Intermediate  786 10.90% 0.00% 1.27% 87.79% NA
Temperate Japonica  767 89.40% 6.00% 1.69% 2.87% NA
Tropical Japonica  504 83.50% 0.60% 1.19% 14.68% NA
Japonica Intermediate  241 92.50% 4.10% 0.00% 3.32% NA
VI/Aromatic  96 31.20% 0.00% 0.00% 68.75% NA
Intermediate  90 44.40% 0.00% 1.11% 54.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611571279 G -> A LOC_Os06g20170.1 missense_variant ; p.Ala631Val; MODERATE nonsynonymous_codon ; A631V Average:7.922; most accessible tissue: Minghui63 panicle, score: 16.27 benign 0.491 DELETERIOUS 0.01
vg0611571279 G -> DEL LOC_Os06g20170.1 N frameshift_variant Average:7.922; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611571279 NA 3.62E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0611571279 NA 1.26E-06 mr1179 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611571279 NA 2.31E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611571279 NA 7.86E-10 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611571279 NA 1.86E-07 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611571279 NA 1.59E-08 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611571279 NA 1.52E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611571279 NA 5.05E-06 mr1686_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611571279 NA 7.49E-07 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251