\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611557966:

Variant ID: vg0611557966 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11557966
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.65, C: 0.35, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


TTCATTTCTCAATTCCCCATCCCCATCCCACTAAAATTTTTATGTCCCCCAACCAAATAAAACAGTTAATAGCCTCATCCCTCTAAACTGCCAATCCATC[A/C]
TAAAAACTTCCTCCAACCAAACAGACCGTAAGTATCATGTCAAAGTCGTGGCACCACCTCTGAGTTAGAGGAGGAGAAGCCTAGCATAAATCTAGGCGTT

Reverse complement sequence

AACGCCTAGATTTATGCTAGGCTTCTCCTCCTCTAACTCAGAGGTGGTGCCACGACTTTGACATGATACTTACGGTCTGTTTGGTTGGAGGAAGTTTTTA[T/G]
GATGGATTGGCAGTTTAGAGGGATGAGGCTATTAACTGTTTTATTTGGTTGGGGGACATAAAAATTTTAGTGGGATGGGGATGGGGAATTGAGAAATGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.60% 14.90% 0.51% 47.00% NA
All Indica  2759 5.80% 20.80% 0.54% 72.85% NA
All Japonica  1512 89.60% 0.20% 0.20% 10.05% NA
Aus  269 73.20% 19.70% 0.37% 6.69% NA
Indica I  595 11.30% 10.90% 0.67% 77.14% NA
Indica II  465 3.40% 1.10% 0.22% 95.27% NA
Indica III  913 1.80% 34.80% 0.44% 62.98% NA
Indica Intermediate  786 7.90% 23.50% 0.76% 67.81% NA
Temperate Japonica  767 96.50% 0.00% 0.13% 3.39% NA
Tropical Japonica  504 76.00% 0.20% 0.40% 23.41% NA
Japonica Intermediate  241 95.90% 0.80% 0.00% 3.32% NA
VI/Aromatic  96 25.00% 68.80% 1.04% 5.21% NA
Intermediate  90 43.30% 12.20% 4.44% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611557966 A -> C LOC_Os06g20150.1 upstream_gene_variant ; 1604.0bp to feature; MODIFIER silent_mutation Average:46.466; most accessible tissue: Callus, score: 89.549 N N N N
vg0611557966 A -> C LOC_Os06g20140.1 downstream_gene_variant ; 1064.0bp to feature; MODIFIER silent_mutation Average:46.466; most accessible tissue: Callus, score: 89.549 N N N N
vg0611557966 A -> C LOC_Os06g20140-LOC_Os06g20150 intergenic_region ; MODIFIER silent_mutation Average:46.466; most accessible tissue: Callus, score: 89.549 N N N N
vg0611557966 A -> DEL N N silent_mutation Average:46.466; most accessible tissue: Callus, score: 89.549 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611557966 NA 1.45E-09 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557966 NA 1.54E-10 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557966 NA 9.47E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557966 NA 7.32E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557966 NA 5.08E-09 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557966 NA 4.27E-09 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557966 6.60E-07 1.30E-10 mr1860 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557966 4.33E-07 2.70E-11 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557966 5.59E-07 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557966 8.55E-08 1.38E-13 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557966 NA 5.53E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557966 5.67E-06 NA mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557966 NA 1.16E-09 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557966 1.88E-06 NA mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557966 4.21E-06 1.54E-10 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557966 NA 1.30E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557966 NA 8.70E-10 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557966 NA 4.91E-08 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557966 NA 2.57E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557966 NA 3.56E-07 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251