\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611557848:

Variant ID: vg0611557848 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11557848
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.57, G: 0.44, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GAGTTTAGTTGGAGATTAGATTATAATGAAAACGGATGGCTGAGATTTGTTTAGGCGAAGTAAAGGAGGAATTCCCTCCCAATTACCTGCCCCTACCCAG[A/G]
TATTGAAAAGAAGGGAGTTCATTTCTCAATTCCCCATCCCCATCCCACTAAAATTTTTATGTCCCCCAACCAAATAAAACAGTTAATAGCCTCATCCCTC

Reverse complement sequence

GAGGGATGAGGCTATTAACTGTTTTATTTGGTTGGGGGACATAAAAATTTTAGTGGGATGGGGATGGGGAATTGAGAAATGAACTCCCTTCTTTTCAATA[T/C]
CTGGGTAGGGGCAGGTAATTGGGAGGGAATTCCTCCTTTACTTCGCCTAAACAAATCTCAGCCATCCGTTTTCATTATAATCTAATCTCCAACTAAACTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.80% 9.00% 0.23% 47.97% NA
All Indica  2759 14.80% 10.70% 0.25% 74.34% NA
All Japonica  1512 89.50% 0.40% 0.07% 10.05% NA
Aus  269 72.50% 19.70% 0.00% 7.81% NA
Indica I  595 8.60% 10.80% 0.17% 80.50% NA
Indica II  465 3.20% 0.40% 0.43% 95.91% NA
Indica III  913 24.80% 11.50% 0.11% 63.64% NA
Indica Intermediate  786 14.60% 15.60% 0.38% 69.34% NA
Temperate Japonica  767 96.30% 0.00% 0.00% 3.65% NA
Tropical Japonica  504 76.00% 0.60% 0.20% 23.21% NA
Japonica Intermediate  241 95.90% 1.20% 0.00% 2.90% NA
VI/Aromatic  96 27.10% 66.70% 1.04% 5.21% NA
Intermediate  90 45.60% 10.00% 2.22% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611557848 A -> G LOC_Os06g20150.1 upstream_gene_variant ; 1722.0bp to feature; MODIFIER silent_mutation Average:27.733; most accessible tissue: Zhenshan97 root, score: 55.432 N N N N
vg0611557848 A -> G LOC_Os06g20140.1 downstream_gene_variant ; 946.0bp to feature; MODIFIER silent_mutation Average:27.733; most accessible tissue: Zhenshan97 root, score: 55.432 N N N N
vg0611557848 A -> G LOC_Os06g20140-LOC_Os06g20150 intergenic_region ; MODIFIER silent_mutation Average:27.733; most accessible tissue: Zhenshan97 root, score: 55.432 N N N N
vg0611557848 A -> DEL N N silent_mutation Average:27.733; most accessible tissue: Zhenshan97 root, score: 55.432 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611557848 NA 2.28E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557848 NA 1.34E-07 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557848 NA 3.58E-08 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557848 NA 2.14E-07 mr1150 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557848 NA 3.94E-09 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557848 4.33E-06 7.06E-11 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557848 NA 7.76E-08 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557848 NA 1.69E-07 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557848 NA 1.55E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557848 NA 5.09E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557848 NA 8.45E-06 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251