Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611557848:

Variant ID: vg0611557848 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 11557848
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.57, G: 0.44, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

GAGTTTAGTTGGAGATTAGATTATAATGAAAACGGATGGCTGAGATTTGTTTAGGCGAAGTAAAGGAGGAATTCCCTCCCAATTACCTGCCCCTACCCAG[A/G]
TATTGAAAAGAAGGGAGTTCATTTCTCAATTCCCCATCCCCATCCCACTAAAATTTTTATGTCCCCCAACCAAATAAAACAGTTAATAGCCTCATCCCTC

Reverse complement sequence

GAGGGATGAGGCTATTAACTGTTTTATTTGGTTGGGGGACATAAAAATTTTAGTGGGATGGGGATGGGGAATTGAGAAATGAACTCCCTTCTTTTCAATA[T/C]
CTGGGTAGGGGCAGGTAATTGGGAGGGAATTCCTCCTTTACTTCGCCTAAACAAATCTCAGCCATCCGTTTTCATTATAATCTAATCTCCAACTAAACTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.80%	9.00%	0.23%	47.97%	NA
All Indica	2759	14.80%	10.70%	0.25%	74.34%	NA
All Japonica	1512	89.50%	0.40%	0.07%	10.05%	NA
Aus	269	72.50%	19.70%	0.00%	7.81%	NA
Indica I	595	8.60%	10.80%	0.17%	80.50%	NA
Indica II	465	3.20%	0.40%	0.43%	95.91%	NA
Indica III	913	24.80%	11.50%	0.11%	63.64%	NA
Indica Intermediate	786	14.60%	15.60%	0.38%	69.34%	NA
Temperate Japonica	767	96.30%	0.00%	0.00%	3.65%	NA
Tropical Japonica	504	76.00%	0.60%	0.20%	23.21%	NA
Japonica Intermediate	241	95.90%	1.20%	0.00%	2.90%	NA
VI/Aromatic	96	27.10%	66.70%	1.04%	5.21%	NA
Intermediate	90	45.60%	10.00%	2.22%	42.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0611557848	A -> G	LOC_Os06g20150.1	upstream_gene_variant ; 1722.0bp to feature; MODIFIER	silent_mutation	Average:27.733; most accessible tissue: Zhenshan97 root, score: 55.432	N	N	N	N
vg0611557848	A -> G	LOC_Os06g20140.1	downstream_gene_variant ; 946.0bp to feature; MODIFIER	silent_mutation	Average:27.733; most accessible tissue: Zhenshan97 root, score: 55.432	N	N	N	N
vg0611557848	A -> G	LOC_Os06g20140-LOC_Os06g20150	intergenic_region ; MODIFIER	silent_mutation	Average:27.733; most accessible tissue: Zhenshan97 root, score: 55.432	N	N	N	N
vg0611557848	A -> DEL	N	N	silent_mutation	Average:27.733; most accessible tissue: Zhenshan97 root, score: 55.432	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0611557848	NA	2.28E-06	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557848	NA	1.34E-07	mr1098	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557848	NA	3.58E-08	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557848	NA	2.14E-07	mr1150	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557848	NA	3.94E-09	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557848	4.33E-06	7.06E-11	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557848	NA	7.76E-08	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557848	NA	1.69E-07	mr1218_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557848	NA	1.55E-09	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557848	NA	5.09E-07	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611557848	NA	8.45E-06	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251