\
| Variant ID: vg0611557848 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11557848 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.57, G: 0.44, others allele: 0.00, population size: 90. )
GAGTTTAGTTGGAGATTAGATTATAATGAAAACGGATGGCTGAGATTTGTTTAGGCGAAGTAAAGGAGGAATTCCCTCCCAATTACCTGCCCCTACCCAG[A/G]
TATTGAAAAGAAGGGAGTTCATTTCTCAATTCCCCATCCCCATCCCACTAAAATTTTTATGTCCCCCAACCAAATAAAACAGTTAATAGCCTCATCCCTC
GAGGGATGAGGCTATTAACTGTTTTATTTGGTTGGGGGACATAAAAATTTTAGTGGGATGGGGATGGGGAATTGAGAAATGAACTCCCTTCTTTTCAATA[T/C]
CTGGGTAGGGGCAGGTAATTGGGAGGGAATTCCTCCTTTACTTCGCCTAAACAAATCTCAGCCATCCGTTTTCATTATAATCTAATCTCCAACTAAACTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.80% | 9.00% | 0.23% | 47.97% | NA |
| All Indica | 2759 | 14.80% | 10.70% | 0.25% | 74.34% | NA |
| All Japonica | 1512 | 89.50% | 0.40% | 0.07% | 10.05% | NA |
| Aus | 269 | 72.50% | 19.70% | 0.00% | 7.81% | NA |
| Indica I | 595 | 8.60% | 10.80% | 0.17% | 80.50% | NA |
| Indica II | 465 | 3.20% | 0.40% | 0.43% | 95.91% | NA |
| Indica III | 913 | 24.80% | 11.50% | 0.11% | 63.64% | NA |
| Indica Intermediate | 786 | 14.60% | 15.60% | 0.38% | 69.34% | NA |
| Temperate Japonica | 767 | 96.30% | 0.00% | 0.00% | 3.65% | NA |
| Tropical Japonica | 504 | 76.00% | 0.60% | 0.20% | 23.21% | NA |
| Japonica Intermediate | 241 | 95.90% | 1.20% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 27.10% | 66.70% | 1.04% | 5.21% | NA |
| Intermediate | 90 | 45.60% | 10.00% | 2.22% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611557848 | A -> G | LOC_Os06g20150.1 | upstream_gene_variant ; 1722.0bp to feature; MODIFIER | silent_mutation | Average:27.733; most accessible tissue: Zhenshan97 root, score: 55.432 | N | N | N | N |
| vg0611557848 | A -> G | LOC_Os06g20140.1 | downstream_gene_variant ; 946.0bp to feature; MODIFIER | silent_mutation | Average:27.733; most accessible tissue: Zhenshan97 root, score: 55.432 | N | N | N | N |
| vg0611557848 | A -> G | LOC_Os06g20140-LOC_Os06g20150 | intergenic_region ; MODIFIER | silent_mutation | Average:27.733; most accessible tissue: Zhenshan97 root, score: 55.432 | N | N | N | N |
| vg0611557848 | A -> DEL | N | N | silent_mutation | Average:27.733; most accessible tissue: Zhenshan97 root, score: 55.432 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611557848 | NA | 2.28E-06 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611557848 | NA | 1.34E-07 | mr1098 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611557848 | NA | 3.58E-08 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611557848 | NA | 2.14E-07 | mr1150 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611557848 | NA | 3.94E-09 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611557848 | 4.33E-06 | 7.06E-11 | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611557848 | NA | 7.76E-08 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611557848 | NA | 1.69E-07 | mr1218_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611557848 | NA | 1.55E-09 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611557848 | NA | 5.09E-07 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611557848 | NA | 8.45E-06 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |