Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611539119:

Variant ID: vg0611539119 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 11539119
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCAAAACTCCGAGAAATGGATAGAGGAAGGTCTAAGGAGTCCACCGACCGAAGGCCAGGCCAGGAGGGCCTAGCCCAGGTTTGACCGAACCCCCTGGTT[C/T]
GGCCGAACCCCCCTGATCACCGTTGATCCTGGGGTTTGGCGTGGACACTCCAGATCACTCCCTGATGGCGCTTGCGGGGTACTTCGGACATTTCCCTTTC

Reverse complement sequence

GAAAGGGAAATGTCCGAAGTACCCCGCAAGCGCCATCAGGGAGTGATCTGGAGTGTCCACGCCAAACCCCAGGATCAACGGTGATCAGGGGGGTTCGGCC[G/A]
AACCAGGGGGTTCGGTCAAACCTGGGCTAGGCCCTCCTGGCCTGGCCTTCGGTCGGTGGACTCCTTAGACCTTCCTCTATCCATTTCTCGGAGTTTTGGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.50%	5.50%	14.73%	31.29%	NA
All Indica	2759	20.50%	9.40%	22.94%	47.19%	NA
All Japonica	1512	90.50%	0.00%	2.18%	7.28%	NA
Aus	269	95.50%	0.00%	2.97%	1.49%	NA
Indica I	595	14.30%	0.20%	15.80%	69.75%	NA
Indica II	465	12.00%	0.60%	26.02%	61.29%	NA
Indica III	913	23.90%	23.00%	24.97%	28.15%	NA
Indica Intermediate	786	26.30%	5.60%	24.17%	43.89%	NA
Temperate Japonica	767	96.60%	0.00%	0.52%	2.87%	NA
Tropical Japonica	504	78.60%	0.00%	5.75%	15.67%	NA
Japonica Intermediate	241	96.30%	0.00%	0.00%	3.73%	NA
VI/Aromatic	96	47.90%	1.00%	10.42%	40.62%	NA
Intermediate	90	57.80%	2.20%	13.33%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0611539119	C -> T	LOC_Os06g20120.1	downstream_gene_variant ; 1675.0bp to feature; MODIFIER	silent_mutation	Average:19.684; most accessible tissue: Zhenshan97 flag leaf, score: 25.809	N	N	N	N
vg0611539119	C -> T	LOC_Os06g20120-LOC_Os06g20130	intergenic_region ; MODIFIER	silent_mutation	Average:19.684; most accessible tissue: Zhenshan97 flag leaf, score: 25.809	N	N	N	N
vg0611539119	C -> DEL	N	N	silent_mutation	Average:19.684; most accessible tissue: Zhenshan97 flag leaf, score: 25.809	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0611539119	NA	8.10E-06	mr1054	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539119	NA	6.94E-06	mr1287	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539119	NA	1.74E-07	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539119	NA	6.56E-07	mr1483	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539119	4.06E-06	4.06E-06	mr1483	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539119	NA	4.65E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539119	NA	4.90E-07	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539119	NA	7.72E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539119	NA	7.09E-06	mr1875	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251