\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611526397:

Variant ID: vg0611526397 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11526397
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TGATGATATTAGAGACTGATGCTGATCATGATGATGATATTGGAGTACTATGGTGACGATCTTGATGATATGAAGTCATATTCTTGCCATTCATTTGAAC[C/T]
AATTAGCTTGAGATTCATTAAGAAAACTATTTGTATGAAATCAAATGTTTAGCTAATTTTACTGTACTAATAGAGTACTGGAAAACTCACAGTGCTTGTA

Reverse complement sequence

TACAAGCACTGTGAGTTTTCCAGTACTCTATTAGTACAGTAAAATTAGCTAAACATTTGATTTCATACAAATAGTTTTCTTAATGAATCTCAAGCTAATT[G/A]
GTTCAAATGAATGGCAAGAATATGACTTCATATCATCAAGATCGTCACCATAGTACTCCAATATCATCATCATGATCAGCATCAGTCTCTAATATCATCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 31.10% 0.38% 1.06% NA
All Indica  2759 56.20% 41.60% 0.47% 1.67% NA
All Japonica  1512 89.60% 10.00% 0.26% 0.13% NA
Aus  269 72.50% 26.80% 0.00% 0.74% NA
Indica I  595 73.60% 25.90% 0.34% 0.17% NA
Indica II  465 77.60% 21.70% 0.43% 0.22% NA
Indica III  913 35.20% 61.10% 0.11% 3.61% NA
Indica Intermediate  786 54.80% 42.70% 1.02% 1.40% NA
Temperate Japonica  767 96.20% 3.30% 0.52% 0.00% NA
Tropical Japonica  504 76.20% 23.40% 0.00% 0.40% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 32.30% 67.70% 0.00% 0.00% NA
Intermediate  90 60.00% 38.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611526397 C -> T LOC_Os06g20090.1 3_prime_UTR_variant ; 714.0bp to feature; MODIFIER silent_mutation Average:62.609; most accessible tissue: Callus, score: 82.866 N N N N
vg0611526397 C -> T LOC_Os06g20100.1 upstream_gene_variant ; 2413.0bp to feature; MODIFIER silent_mutation Average:62.609; most accessible tissue: Callus, score: 82.866 N N N N
vg0611526397 C -> DEL N N silent_mutation Average:62.609; most accessible tissue: Callus, score: 82.866 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611526397 4.81E-06 NA mr1020 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 2.68E-06 1.29E-09 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 NA 1.51E-06 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 NA 1.44E-11 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 2.28E-06 2.28E-06 mr1144 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 2.07E-06 2.07E-06 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 NA 6.13E-10 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 NA 1.57E-06 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 1.89E-08 1.89E-08 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 NA 6.89E-07 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 NA 4.51E-08 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 1.06E-06 6.95E-08 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 5.99E-07 2.34E-10 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 2.10E-08 1.65E-10 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 4.73E-07 2.52E-12 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 1.59E-06 1.09E-08 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 NA 2.52E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 NA 4.10E-10 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 3.78E-06 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 7.24E-07 7.24E-07 mr1477_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 1.74E-06 7.64E-09 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 NA 6.44E-11 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611526397 NA 1.07E-06 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251