Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611519166:

Variant ID: vg0611519166 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 11519166
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, A: 0.33, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

TTTCTACTGATGGTGTCACAATGACATGCATCACTTGTACAGATAAGGGTCAAATTTTCCTATCTGGGCGTGATGGCCATATATATGAGCTGCAATATAC[A/G]
ACTGGTTCAGGTTGGCGAAAGCGCTGCCGTAAAGTTTGCCTTACTACTGGTTTAGGCAGCCTTCTTTCCAGGTACTAAAGCTGTAGGACAAGAAATGTGA

Reverse complement sequence

TCACATTTCTTGTCCTACAGCTTTAGTACCTGGAAAGAAGGCTGCCTAAACCAGTAGTAAGGCAAACTTTACGGCAGCGCTTTCGCCAACCTGAACCAGT[T/C]
GTATATTGCAGCTCATATATATGGCCATCACGCCCAGATAGGAAAATTTGACCCTTATCTGTACAAGTGATGCATGTCATTGTGACACCATCAGTAGAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.60%	32.20%	0.11%	0.00%	NA
All Indica	2759	56.50%	43.30%	0.14%	0.00%	NA
All Japonica	1512	89.90%	10.00%	0.07%	0.00%	NA
Aus	269	72.50%	27.50%	0.00%	0.00%	NA
Indica I	595	73.40%	26.10%	0.50%	0.00%	NA
Indica II	465	77.60%	22.20%	0.22%	0.00%	NA
Indica III	913	35.40%	64.60%	0.00%	0.00%	NA
Indica Intermediate	786	55.70%	44.30%	0.00%	0.00%	NA
Temperate Japonica	767	96.90%	3.00%	0.13%	0.00%	NA
Tropical Japonica	504	76.20%	23.80%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	3.30%	0.00%	0.00%	NA
VI/Aromatic	96	32.30%	67.70%	0.00%	0.00%	NA
Intermediate	90	57.80%	42.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0611519166	A -> G	LOC_Os06g20090.1	synonymous_variant ; p.Thr217Thr; LOW	synonymous_codon	Average:54.321; most accessible tissue: Zhenshan97 young leaf, score: 73.147	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0611519166	4.03E-06	8.23E-07	mr1020	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	4.64E-08	4.64E-08	mr1032	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	NA	4.15E-09	mr1087	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	NA	1.44E-06	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	5.09E-06	4.62E-12	mr1091	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	NA	6.69E-06	mr1094	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	NA	4.99E-06	mr1096	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	6.30E-06	6.30E-06	mr1144	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	9.05E-07	9.05E-07	mr1165	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	NA	4.27E-08	mr1218	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	NA	8.23E-06	mr1422	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	3.03E-10	3.03E-10	mr1478	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	NA	1.32E-06	mr1583	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	NA	1.67E-08	mr1877	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	5.65E-09	3.15E-10	mr1971	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	9.66E-08	1.51E-10	mr1065_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	3.72E-08	3.44E-10	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	3.12E-07	3.17E-12	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	NA	1.34E-07	mr1218_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	NA	2.49E-09	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	3.10E-06	3.10E-06	mr1477_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	1.98E-06	1.02E-08	mr1526_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	NA	8.48E-06	mr1536_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	NA	3.15E-10	mr1850_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611519166	NA	8.50E-07	mr1877_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251