\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611497725:

Variant ID: vg0611497725 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11497725
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


CGGTATGTTCCTCGTAAAATAGAAAAAACCGAGTTTAGTCCAAAAATTTATCTCGATGTTCCTAGCTTAATACATAGCTATCCTAGATAATTATGTCATG[G/A]
AGCACCATATAGGATGATTACGACATGCATGATAATAATGAGGAAACTGTCATCTAACCGACCACGTGACAAGGCTGACAAGGCTATTCAGATTATGCCA

Reverse complement sequence

TGGCATAATCTGAATAGCCTTGTCAGCCTTGTCACGTGGTCGGTTAGATGACAGTTTCCTCATTATTATCATGCATGTCGTAATCATCCTATATGGTGCT[C/T]
CATGACATAATTATCTAGGATAGCTATGTATTAAGCTAGGAACATCGAGATAAATTTTTGGACTAAACTCGGTTTTTTCTATTTTACGAGGAACATACCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 31.30% 0.57% 0.13% NA
All Indica  2759 56.90% 42.10% 0.72% 0.22% NA
All Japonica  1512 90.10% 9.90% 0.07% 0.00% NA
Aus  269 73.20% 26.40% 0.37% 0.00% NA
Indica I  595 73.80% 25.90% 0.34% 0.00% NA
Indica II  465 78.50% 21.30% 0.22% 0.00% NA
Indica III  913 35.60% 62.30% 1.53% 0.55% NA
Indica Intermediate  786 56.20% 43.30% 0.38% 0.13% NA
Temperate Japonica  767 97.00% 3.00% 0.00% 0.00% NA
Tropical Japonica  504 76.40% 23.40% 0.20% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 32.30% 64.60% 3.12% 0.00% NA
Intermediate  90 57.80% 40.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611497725 G -> A LOC_Os06g20040.1 upstream_gene_variant ; 3455.0bp to feature; MODIFIER silent_mutation Average:59.297; most accessible tissue: Minghui63 root, score: 69.846 N N N N
vg0611497725 G -> A LOC_Os06g20050.1 upstream_gene_variant ; 1267.0bp to feature; MODIFIER silent_mutation Average:59.297; most accessible tissue: Minghui63 root, score: 69.846 N N N N
vg0611497725 G -> A LOC_Os06g20040-LOC_Os06g20050 intergenic_region ; MODIFIER silent_mutation Average:59.297; most accessible tissue: Minghui63 root, score: 69.846 N N N N
vg0611497725 G -> DEL N N silent_mutation Average:59.297; most accessible tissue: Minghui63 root, score: 69.846 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611497725 NA 4.18E-08 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611497725 NA 1.32E-07 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611497725 7.58E-07 7.53E-07 mr1197_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611497725 NA 6.44E-09 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251