Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611453377:

Variant ID: vg0611453377 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 11453377
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATCGAGGAGGCCTGTGCCGAGGCGGAGCAGGCTGAAGCTTCAGGACTGAAGGTGGAGCAGCACTGCTCGGAGCATGTTCAGGGTGATATGAGCAAATGC[G/A]
GCTCGGAGGAAGACAAGAGTATTAAGAAAGATAATAAGTTGATGAAGAAGAAGAAGAAGAAAGAGAGAAAAGTGGAGATGGCTGAAGAGGGGCAGATACT

Reverse complement sequence

AGTATCTGCCCCTCTTCAGCCATCTCCACTTTTCTCTCTTTCTTCTTCTTCTTCTTCATCAACTTATTATCTTTCTTAATACTCTTGTCTTCCTCCGAGC[C/T]
GCATTTGCTCATATCACCCTGAACATGCTCCGAGCAGTGCTGCTCCACCTTCAGTCCTGAAGCTTCAGCCTGCTCCGCCTCGGCACAGGCCTCCTCGATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.10%	20.30%	2.54%	0.00%	NA
All Indica	2759	97.40%	2.10%	0.54%	0.00%	NA
All Japonica	1512	53.60%	40.00%	6.35%	0.00%	NA
Aus	269	27.90%	69.90%	2.23%	0.00%	NA
Indica I	595	95.00%	3.40%	1.68%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	99.20%	0.80%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	2.80%	0.64%	0.00%	NA
Temperate Japonica	767	75.40%	15.90%	8.74%	0.00%	NA
Tropical Japonica	504	28.20%	69.20%	2.58%	0.00%	NA
Japonica Intermediate	241	37.80%	55.60%	6.64%	0.00%	NA
VI/Aromatic	96	16.70%	83.30%	0.00%	0.00%	NA
Intermediate	90	63.30%	33.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0611453377	G -> A	LOC_Os06g19980.1	missense_variant ; p.Gly119Ser; MODERATE	nonsynonymous_codon ; G119S	Average:77.479; most accessible tissue: Zhenshan97 young leaf, score: 86.383	unknown	unknown	TOLERATED	0.71

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0611453377	NA	1.59E-08	mr1465	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611453377	NA	6.03E-08	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611453377	NA	1.05E-11	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611453377	NA	9.16E-14	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611453377	NA	3.30E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611453377	NA	1.05E-09	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611453377	NA	1.19E-09	mr1341_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611453377	NA	8.79E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611453377	NA	3.37E-08	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611453377	NA	1.92E-08	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611453377	NA	1.76E-29	mr1580_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611453377	NA	5.73E-08	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611453377	NA	1.13E-11	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611453377	NA	8.03E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611453377	NA	6.72E-09	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251