\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611444151:

Variant ID: vg0611444151 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11444151
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, T: 0.32, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGCATTTCAGGCCCAAAGAGGTATCTGTCATAATTACTTTTTTTTCCCACTGGACACATAATATCTCTGCTAATGGGGAAGGTGCAATATGCTGAGTT[C/T]
TTTTTATTTATCATTCTGTAGGCCTCATGACCGTGTCCCTTTGAAGGAAATGAAATCAGATTGGCATGCTTGCCTAGACAGCAGAGTTGGTTTCAAGGTA

Reverse complement sequence

TACCTTGAAACCAACTCTGCTGTCTAGGCAAGCATGCCAATCTGATTTCATTTCCTTCAAAGGGACACGGTCATGAGGCCTACAGAATGATAAATAAAAA[G/A]
AACTCAGCATATTGCACCTTCCCCATTAGCAGAGATATTATGTGTCCAGTGGGAAAAAAAAGTAATTATGACAGATACCTCTTTGGGCCTGAAATGCAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.60% 14.30% 0.68% 45.37% NA
All Indica  2759 4.60% 21.40% 0.94% 73.00% NA
All Japonica  1512 92.70% 4.60% 0.00% 2.65% NA
Aus  269 77.70% 0.00% 1.12% 21.19% NA
Indica I  595 7.60% 2.00% 0.50% 89.92% NA
Indica II  465 2.80% 6.20% 1.29% 89.68% NA
Indica III  913 1.60% 43.70% 1.10% 53.56% NA
Indica Intermediate  786 7.00% 19.20% 0.89% 72.90% NA
Temperate Japonica  767 96.30% 0.30% 0.00% 3.39% NA
Tropical Japonica  504 86.50% 12.50% 0.00% 0.99% NA
Japonica Intermediate  241 94.20% 2.10% 0.00% 3.73% NA
VI/Aromatic  96 84.40% 7.30% 1.04% 7.29% NA
Intermediate  90 57.80% 11.10% 2.22% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611444151 C -> T LOC_Os06g19970.1 downstream_gene_variant ; 4575.0bp to feature; MODIFIER silent_mutation Average:7.385; most accessible tissue: Callus, score: 36.564 N N N N
vg0611444151 C -> T LOC_Os06g19960.1 intron_variant ; MODIFIER silent_mutation Average:7.385; most accessible tissue: Callus, score: 36.564 N N N N
vg0611444151 C -> DEL N N silent_mutation Average:7.385; most accessible tissue: Callus, score: 36.564 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611444151 NA 5.08E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611444151 NA 4.13E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611444151 NA 3.62E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611444151 NA 1.65E-06 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611444151 NA 1.97E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611444151 NA 1.30E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611444151 NA 7.69E-08 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611444151 NA 1.17E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611444151 NA 1.33E-07 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611444151 NA 3.25E-06 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611444151 NA 2.80E-07 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611444151 NA 7.59E-08 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611444151 NA 1.29E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611444151 NA 1.01E-07 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611444151 NA 3.53E-08 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611444151 1.69E-06 NA mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611444151 1.94E-06 3.00E-06 mr1165_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611444151 NA 4.27E-09 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611444151 NA 5.21E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251