\
| Variant ID: vg0611438806 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11438806 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.77, G: 0.23, others allele: 0.00, population size: 97. )
TGACGACTTGCAAGTTACAAAGAACGATGTCGAGACAATTATCAATTGGGAAAAGACATCTCCAAAGCTGGCTGAGATACCATTCAAGCCAGCAAGATGT[G/A]
TCCTAATGGTCTTGAATTGACACATCACACAAAGTATTAGTATTGTTTTATATAAATGTCTTTTGCTTATAATCGGATTTACTCACTAGGACAACACTGG
CCAGTGTTGTCCTAGTGAGTAAATCCGATTATAAGCAAAAGACATTTATATAAAACAATACTAATACTTTGTGTGATGTGTCAATTCAAGACCATTAGGA[C/T]
ACATCTTGCTGGCTTGAATGGTATCTCAGCCAGCTTTGGAGATGTCTTTTCCCAATTGATAATTGTCTCGACATCGTTCTTTGTAACTTGCAAGTCGTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.90% | 16.10% | 1.23% | 44.84% | NA |
| All Indica | 2759 | 4.30% | 21.80% | 1.78% | 72.09% | NA |
| All Japonica | 1512 | 88.50% | 8.80% | 0.33% | 2.38% | NA |
| Aus | 269 | 75.50% | 0.40% | 1.49% | 22.68% | NA |
| Indica I | 595 | 7.40% | 2.00% | 2.52% | 88.07% | NA |
| Indica II | 465 | 2.80% | 6.70% | 1.29% | 89.25% | NA |
| Indica III | 913 | 1.20% | 44.10% | 1.53% | 53.12% | NA |
| Indica Intermediate | 786 | 6.60% | 19.70% | 1.78% | 71.88% | NA |
| Temperate Japonica | 767 | 95.80% | 0.50% | 0.39% | 3.26% | NA |
| Tropical Japonica | 504 | 74.80% | 24.20% | 0.20% | 0.79% | NA |
| Japonica Intermediate | 241 | 93.80% | 2.90% | 0.41% | 2.90% | NA |
| VI/Aromatic | 96 | 85.40% | 7.30% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 52.20% | 18.90% | 0.00% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611438806 | G -> A | LOC_Os06g19960.1 | upstream_gene_variant ; 346.0bp to feature; MODIFIER | silent_mutation | Average:11.97; most accessible tissue: Callus, score: 86.999 | N | N | N | N |
| vg0611438806 | G -> A | LOC_Os06g19950-LOC_Os06g19960 | intergenic_region ; MODIFIER | silent_mutation | Average:11.97; most accessible tissue: Callus, score: 86.999 | N | N | N | N |
| vg0611438806 | G -> DEL | N | N | silent_mutation | Average:11.97; most accessible tissue: Callus, score: 86.999 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611438806 | NA | 4.61E-09 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438806 | NA | 3.47E-07 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438806 | NA | 1.44E-06 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438806 | NA | 1.43E-07 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438806 | NA | 2.23E-06 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438806 | NA | 2.47E-08 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438806 | NA | 3.24E-09 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438806 | NA | 3.26E-06 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438806 | NA | 2.93E-07 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438806 | NA | 3.15E-07 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438806 | NA | 2.30E-06 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438806 | NA | 6.32E-08 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438806 | 1.92E-07 | NA | mr1165_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438806 | NA | 1.51E-08 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438806 | 5.28E-06 | NA | mr1971_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |