\
| Variant ID: vg0611438317 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11438317 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.24, others allele: 0.00, population size: 103. )
GATCGTTCATTTGCTAGCTTTTTTTTTTACGAAAAACAGCAGGAAAGACTGCTAGTTCTTTACATTACTTAGCTGTACAGTTTTTTTTTTCTCAAATACG[C/T]
TAAAGAGTTGTGTAATAGTTCATTAAGATAGGAGGGAAGCAAAAGCATCCCTCACCCTACAAACGTACAGGACTTACGTTTACAAGAAAAATAAAACAAA
TTTGTTTTATTTTTCTTGTAAACGTAAGTCCTGTACGTTTGTAGGGTGAGGGATGCTTTTGCTTCCCTCCTATCTTAATGAACTATTACACAACTCTTTA[G/A]
CGTATTTGAGAAAAAAAAAACTGTACAGCTAAGTAATGTAAAGAACTAGCAGTCTTTCCTGCTGTTTTTCGTAAAAAAAAAAGCTAGCAAATGAACGATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.80% | 15.80% | 0.70% | 45.75% | NA |
| All Indica | 2759 | 4.20% | 21.40% | 0.91% | 73.50% | NA |
| All Japonica | 1512 | 88.50% | 8.80% | 0.26% | 2.45% | NA |
| Aus | 269 | 76.20% | 0.00% | 0.37% | 23.42% | NA |
| Indica I | 595 | 7.40% | 2.00% | 1.01% | 89.58% | NA |
| Indica II | 465 | 3.00% | 6.20% | 0.43% | 90.32% | NA |
| Indica III | 913 | 1.20% | 44.00% | 0.44% | 54.33% | NA |
| Indica Intermediate | 786 | 5.90% | 18.80% | 1.65% | 73.66% | NA |
| Temperate Japonica | 767 | 95.80% | 0.50% | 0.39% | 3.26% | NA |
| Tropical Japonica | 504 | 74.80% | 24.20% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 93.80% | 2.90% | 0.41% | 2.90% | NA |
| VI/Aromatic | 96 | 84.40% | 7.30% | 0.00% | 8.33% | NA |
| Intermediate | 90 | 51.10% | 16.70% | 3.33% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611438317 | C -> T | LOC_Os06g19960.1 | upstream_gene_variant ; 835.0bp to feature; MODIFIER | silent_mutation | Average:22.888; most accessible tissue: Callus, score: 60.114 | N | N | N | N |
| vg0611438317 | C -> T | LOC_Os06g19950-LOC_Os06g19960 | intergenic_region ; MODIFIER | silent_mutation | Average:22.888; most accessible tissue: Callus, score: 60.114 | N | N | N | N |
| vg0611438317 | C -> DEL | N | N | silent_mutation | Average:22.888; most accessible tissue: Callus, score: 60.114 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611438317 | NA | 9.48E-09 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438317 | NA | 7.22E-07 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438317 | NA | 6.24E-06 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438317 | NA | 1.04E-07 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438317 | NA | 4.59E-09 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438317 | 9.22E-06 | NA | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438317 | NA | 6.35E-07 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438317 | 4.70E-06 | 9.72E-08 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438317 | NA | 1.78E-06 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438317 | NA | 5.46E-08 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438317 | 2.31E-07 | NA | mr1165_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438317 | NA | 1.22E-08 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611438317 | 1.87E-06 | NA | mr1971_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |