\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611422032:

Variant ID: vg0611422032 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11422032
Reference Allele: AAlternative Allele: G,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATCTCTCTCTCCCTTTGAGTGGGCAGCGACGGGCGGTAGCGCTGCCGCCGACGATGAGGAGGCGTGCGGTCGGGAGCGGGCGGCTCCATCCCCGGCACC[A/G,C]
CTACCACTGCCGCCACCGCCGACGACGACGACGATGAGAAAGCAGCCAAGGGCCCTCAGCTGGCCGACGGCGGGTGGCCTTGGGTGTGATGGGCGGCGCT

Reverse complement sequence

AGCGCCGCCCATCACACCCAAGGCCACCCGCCGTCGGCCAGCTGAGGGCCCTTGGCTGCTTTCTCATCGTCGTCGTCGTCGGCGGTGGCGGCAGTGGTAG[T/C,G]
GGTGCCGGGGATGGAGCCGCCCGCTCCCGACCGCACGCCTCCTCATCGTCGGCGGCAGCGCTACCGCCCGTCGCTGCCCACTCAAAGGGAGAGAGAGATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.50% 43.50% 0.63% 6.31% C: 0.04%
All Indica  2759 77.10% 14.00% 0.54% 8.26% C: 0.07%
All Japonica  1512 6.50% 88.30% 0.86% 4.30% NA
Aus  269 26.00% 74.00% 0.00% 0.00% NA
Indica I  595 88.90% 9.70% 0.17% 1.18% NA
Indica II  465 92.50% 5.60% 0.22% 1.72% NA
Indica III  913 61.90% 23.70% 0.55% 13.80% C: 0.11%
Indica Intermediate  786 76.70% 11.10% 1.02% 11.07% C: 0.13%
Temperate Japonica  767 9.10% 89.20% 1.69% 0.00% NA
Tropical Japonica  504 2.00% 85.70% 0.00% 12.30% NA
Japonica Intermediate  241 7.90% 90.90% 0.00% 1.24% NA
VI/Aromatic  96 8.30% 90.60% 0.00% 1.04% NA
Intermediate  90 38.90% 54.40% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611422032 A -> C LOC_Os06g19950.1 upstream_gene_variant ; 1578.0bp to feature; MODIFIER silent_mutation Average:74.469; most accessible tissue: Minghui63 panicle, score: 88.595 N N N N
vg0611422032 A -> C LOC_Os06g19940.1 intron_variant ; MODIFIER silent_mutation Average:74.469; most accessible tissue: Minghui63 panicle, score: 88.595 N N N N
vg0611422032 A -> G LOC_Os06g19950.1 upstream_gene_variant ; 1578.0bp to feature; MODIFIER silent_mutation Average:74.469; most accessible tissue: Minghui63 panicle, score: 88.595 N N N N
vg0611422032 A -> G LOC_Os06g19940.1 intron_variant ; MODIFIER silent_mutation Average:74.469; most accessible tissue: Minghui63 panicle, score: 88.595 N N N N
vg0611422032 A -> DEL N N silent_mutation Average:74.469; most accessible tissue: Minghui63 panicle, score: 88.595 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0611422032 A C 0.0 0.0 0.0 0.0 -0.01 -0.01
vg0611422032 A G -0.01 0.0 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611422032 NA 1.01E-08 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 NA 3.83E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 1.47E-06 1.57E-08 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 NA 4.83E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 NA 2.67E-07 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 NA 9.64E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 NA 1.66E-45 mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 3.72E-07 1.56E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 NA 7.52E-44 mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 NA 4.99E-42 mr1200 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 2.65E-07 4.37E-11 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 6.53E-08 5.19E-11 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 2.52E-06 NA mr1076_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 1.13E-09 7.26E-12 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 NA 7.08E-07 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 7.05E-08 7.32E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 5.95E-06 NA mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 9.55E-07 7.77E-08 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 1.06E-07 1.16E-10 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 NA 1.08E-06 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 NA 4.25E-49 mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 3.79E-10 2.56E-11 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 4.23E-08 1.42E-11 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 8.27E-06 3.15E-07 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 1.03E-07 5.87E-09 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 NA 3.48E-10 mr1145_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 NA 6.44E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 2.82E-08 1.11E-11 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 1.62E-07 4.20E-07 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 5.39E-06 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 NA 5.26E-07 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 3.26E-06 8.32E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 NA 5.14E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 NA 3.34E-06 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 NA 2.14E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611422032 NA 6.26E-07 mr1878_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251