\
| Variant ID: vg0611421749 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11421749 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AGAACAAACTTTTTTAAGTAGTGCTAACACAAATACGGTGTTTGGCTTAGGAATGATAAACGCATACACGAAAGTTATTTTGTGGCACTGCACACTGGTG[G/C]
AGGTTTTTCTTTTCCCTCGCGGTACTTTTTACTTTACTTGGCCACACCTCCACCAACATGTGAGGTCCTTAAGTGATCCGCATACAAAAATATCTCCTCT
AGAGGAGATATTTTTGTATGCGGATCACTTAAGGACCTCACATGTTGGTGGAGGTGTGGCCAAGTAAAGTAAAAAGTACCGCGAGGGAAAAGAAAAACCT[C/G]
CACCAGTGTGCAGTGCCACAAAATAACTTTCGTGTATGCGTTTATCATTCCTAAGCCAAACACCGTATTTGTGTTAGCACTACTTAAAAAAGTTTGTTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.10% | 38.40% | 0.17% | 6.39% | NA |
| All Indica | 2759 | 86.00% | 5.40% | 0.25% | 8.34% | NA |
| All Japonica | 1512 | 7.10% | 88.50% | 0.00% | 4.37% | NA |
| Aus | 269 | 26.00% | 74.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.10% | 9.10% | 0.17% | 1.68% | NA |
| Indica II | 465 | 95.10% | 2.80% | 0.43% | 1.72% | NA |
| Indica III | 913 | 84.30% | 1.80% | 0.11% | 13.80% | NA |
| Indica Intermediate | 786 | 80.30% | 8.40% | 0.38% | 10.94% | NA |
| Temperate Japonica | 767 | 3.90% | 96.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 12.50% | 75.20% | 0.00% | 12.30% | NA |
| Japonica Intermediate | 241 | 6.20% | 92.50% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 14.60% | 84.40% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 42.20% | 51.10% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611421749 | G -> C | LOC_Os06g19950.1 | upstream_gene_variant ; 1861.0bp to feature; MODIFIER | silent_mutation | Average:63.889; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg0611421749 | G -> C | LOC_Os06g19940.1 | intron_variant ; MODIFIER | silent_mutation | Average:63.889; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg0611421749 | G -> DEL | N | N | silent_mutation | Average:63.889; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611421749 | NA | 8.96E-59 | mr1065 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 5.09E-55 | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 4.56E-57 | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 5.19E-55 | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 8.04E-47 | mr1111 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 9.87E-48 | mr1121 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 8.03E-44 | mr1144 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | 1.61E-07 | NA | mr1148 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 1.08E-09 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 1.04E-44 | mr1200 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 3.21E-51 | mr1211 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 8.25E-30 | mr1237 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 3.75E-09 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 2.01E-14 | mr1261 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 2.52E-62 | mr1065_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 1.41E-67 | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 6.72E-09 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 4.43E-62 | mr1090_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 2.33E-53 | mr1111_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 4.83E-09 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 2.40E-08 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 1.79E-51 | mr1144_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 1.40E-06 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | 7.41E-08 | 3.17E-10 | mr1165_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 1.29E-55 | mr1200_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 4.24E-08 | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 5.02E-59 | mr1211_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 6.74E-06 | mr1341_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 5.57E-58 | mr1526_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | NA | 3.57E-08 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611421749 | 5.61E-08 | 5.61E-08 | mr1971_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |