\
| Variant ID: vg0611413430 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11413430 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.60, C: 0.40, others allele: 0.00, population size: 73. )
TCATGAGCTTCTTTCAGAATTGCATCTTTTAAATCTTTGTTGTCGGGGACGCAGATTCTTTCACCCAACCATACAGTTCCTTGCTCATCTTCCAAGAAAC[T/C]
GATAGCTTTTCCTCTTCTCATATTCTTCTTGATCTCTTGAATATCAGGATCATTAATTTGGGCTTCTCTAACTTGATCAATTAGAGTGGGCTTCGCTTCT
AGAAGCGAAGCCCACTCTAATTGATCAAGTTAGAGAAGCCCAAATTAATGATCCTGATATTCAAGAGATCAAGAAGAATATGAGAAGAGGAAAAGCTATC[A/G]
GTTTCTTGGAAGATGAGCAAGGAACTGTATGGTTGGGTGAAAGAATCTGCGTCCCCGACAACAAAGATTTAAAAGATGCAATTCTGAAAGAAGCTCATGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.50% | 39.80% | 10.81% | 0.89% | NA |
| All Indica | 2759 | 78.30% | 7.10% | 13.34% | 1.27% | NA |
| All Japonica | 1512 | 2.60% | 89.00% | 7.94% | 0.46% | NA |
| Aus | 269 | 21.20% | 75.10% | 3.72% | 0.00% | NA |
| Indica I | 595 | 69.70% | 11.90% | 16.47% | 1.85% | NA |
| Indica II | 465 | 77.40% | 5.80% | 14.84% | 1.94% | NA |
| Indica III | 913 | 87.30% | 2.70% | 9.53% | 0.44% | NA |
| Indica Intermediate | 786 | 74.80% | 9.30% | 14.50% | 1.40% | NA |
| Temperate Japonica | 767 | 2.70% | 96.50% | 0.65% | 0.13% | NA |
| Tropical Japonica | 504 | 2.40% | 76.00% | 20.83% | 0.79% | NA |
| Japonica Intermediate | 241 | 2.50% | 92.50% | 4.15% | 0.83% | NA |
| VI/Aromatic | 96 | 9.40% | 88.50% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 28.90% | 58.90% | 12.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611413430 | T -> C | LOC_Os06g19930.1 | missense_variant ; p.Ser1015Gly; MODERATE | nonsynonymous_codon ; S1015G | Average:12.048; most accessible tissue: Minghui63 panicle, score: 16.27 | benign |
-0.826 |
TOLERATED | 1.00 |
| vg0611413430 | T -> DEL | LOC_Os06g19930.1 | N | frameshift_variant | Average:12.048; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611413430 | NA | 5.22E-06 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611413430 | 1.41E-06 | 6.07E-08 | mr1148 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611413430 | NA | 2.93E-09 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611413430 | NA | 3.76E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611413430 | 5.96E-06 | 5.96E-06 | mr1523 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611413430 | NA | 8.83E-13 | mr1655 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611413430 | NA | 7.26E-07 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611413430 | 7.68E-06 | NA | mr1165_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |