\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611389085:

Variant ID: vg0611389085 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11389085
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACGGATTCTACACGCTGGCACACAAAACGAGGAAAAACTCTAATAAAAACCAAGAAAACAGTACATAAAAAGTAAAAAATCATGTAGAGCTCACTTTTA[T/G]
ATGAATTTTGCAAGTTGAATGGCCCAATTCGGAGTTCAAATGAATTAGATATGAATTTTACAAGTTTTGAGCCATTTTAATGGATTTCTAGAATTAAACC

Reverse complement sequence

GGTTTAATTCTAGAAATCCATTAAAATGGCTCAAAACTTGTAAAATTCATATCTAATTCATTTGAACTCCGAATTGGGCCATTCAACTTGCAAAATTCAT[A/C]
TAAAAGTGAGCTCTACATGATTTTTTACTTTTTATGTACTGTTTTCTTGGTTTTTATTAGAGTTTTTCCTCGTTTTGTGTGCCAGCGTGTAGAATCCGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.70% 36.20% 0.13% 8.99% NA
All Indica  2759 82.90% 4.10% 0.11% 12.90% NA
All Japonica  1512 11.80% 84.30% 0.13% 3.84% NA
Aus  269 26.00% 74.00% 0.00% 0.00% NA
Indica I  595 92.10% 7.10% 0.50% 0.34% NA
Indica II  465 94.60% 2.60% 0.00% 2.80% NA
Indica III  913 67.10% 1.20% 0.00% 31.65% NA
Indica Intermediate  786 87.20% 6.20% 0.00% 6.62% NA
Temperate Japonica  767 11.10% 88.90% 0.00% 0.00% NA
Tropical Japonica  504 14.10% 74.80% 0.40% 10.71% NA
Japonica Intermediate  241 9.10% 89.20% 0.00% 1.66% NA
VI/Aromatic  96 9.40% 83.30% 0.00% 7.29% NA
Intermediate  90 47.80% 46.70% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611389085 T -> G LOC_Os06g19920.1 upstream_gene_variant ; 4890.0bp to feature; MODIFIER silent_mutation Average:40.2; most accessible tissue: Callus, score: 74.062 N N N N
vg0611389085 T -> G LOC_Os06g19910.1 downstream_gene_variant ; 2306.0bp to feature; MODIFIER silent_mutation Average:40.2; most accessible tissue: Callus, score: 74.062 N N N N
vg0611389085 T -> G LOC_Os06g19900.1 intron_variant ; MODIFIER silent_mutation Average:40.2; most accessible tissue: Callus, score: 74.062 N N N N
vg0611389085 T -> DEL N N silent_mutation Average:40.2; most accessible tissue: Callus, score: 74.062 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611389085 NA 8.82E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 2.94E-07 4.79E-10 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 6.85E-08 1.20E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 NA 8.11E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 6.19E-07 4.61E-09 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 NA 1.17E-42 mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 NA 6.27E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 NA 4.51E-43 mr1200 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 NA 7.37E-07 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 NA 7.34E-07 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 4.96E-07 6.98E-12 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 3.29E-08 3.82E-13 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 9.89E-06 2.94E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 8.03E-11 1.70E-13 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 6.05E-10 5.50E-10 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 3.48E-06 NA mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 NA 2.39E-07 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 1.18E-07 2.66E-10 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 1.49E-06 9.40E-11 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 NA 7.00E-07 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 1.89E-10 4.81E-13 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 2.99E-06 5.55E-11 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 7.64E-06 1.11E-08 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 2.87E-07 1.21E-09 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 NA 1.15E-08 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 5.64E-06 1.73E-10 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 1.84E-09 6.92E-10 mr1211_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 4.26E-06 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611389085 1.59E-06 4.63E-09 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251