Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611357651:

Variant ID: vg0611357651 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 11357651
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATTCACCCCCCCCTCTGGTTGGCTTAGTTCTTGTGATTCGATCCTACACTAGTATTAGAGCACTTAGTATGAATACTAAGCAATGAACCCACAAAGATG[A/G]
AAATCTATCTTACTTAGACAAAGTAATTAAATAACATAAGAAAAGAACATGAATGCTTACTTTATAGAAGAAATTCTCCGAATCCAGAGCAGAGTGTACC

Reverse complement sequence

GGTACACTCTGCTCTGGATTCGGAGAATTTCTTCTATAAAGTAAGCATTCATGTTCTTTTCTTATGTTATTTAATTACTTTGTCTAAGTAAGATAGATTT[T/C]
CATCTTTGTGGGTTCATTGCTTAGTATTCATACTAAGTGCTCTAATACTAGTGTAGGATCGAATCACAAGAACTAAGCCAACCAGAGGGGGGGGTGAATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.00%	37.30%	0.83%	8.87%	NA
All Indica	2759	82.20%	4.00%	1.20%	12.65%	NA
All Japonica	1512	7.50%	88.30%	0.13%	4.03%	NA
Aus	269	26.00%	74.00%	0.00%	0.00%	NA
Indica I	595	91.10%	6.60%	1.34%	1.01%	NA
Indica II	465	94.40%	2.60%	2.15%	0.86%	NA
Indica III	913	67.10%	1.30%	0.88%	30.67%	NA
Indica Intermediate	786	85.80%	5.90%	0.89%	7.51%	NA
Temperate Japonica	767	4.30%	95.60%	0.13%	0.00%	NA
Tropical Japonica	504	13.30%	75.00%	0.00%	11.71%	NA
Japonica Intermediate	241	5.80%	92.90%	0.41%	0.83%	NA
VI/Aromatic	96	10.40%	82.30%	2.08%	5.21%	NA
Intermediate	90	45.60%	47.80%	2.22%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0611357651	A -> G	LOC_Os06g19870.1	downstream_gene_variant ; 3445.0bp to feature; MODIFIER	silent_mutation	Average:49.746; most accessible tissue: Zhenshan97 flag leaf, score: 62.519	N	N	N	N
vg0611357651	A -> G	LOC_Os06g19854-LOC_Os06g19870	intergenic_region ; MODIFIER	silent_mutation	Average:49.746; most accessible tissue: Zhenshan97 flag leaf, score: 62.519	N	N	N	N
vg0611357651	A -> DEL	N	N	silent_mutation	Average:49.746; most accessible tissue: Zhenshan97 flag leaf, score: 62.519	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0611357651	NA	1.65E-21	mr1020	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	3.49E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	2.65E-58	mr1065	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	9.55E-44	mr1067	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	2.45E-54	mr1068	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	1.50E-49	mr1078	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	6.96E-30	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	7.18E-06	4.55E-61	mr1087	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	1.79E-58	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	6.64E-56	mr1103	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	1.59E-33	mr1104	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	3.24E-45	mr1108	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	2.85E-46	mr1111	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	9.23E-46	mr1112	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	3.31E-49	mr1121	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	1.86E-44	mr1144	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	8.20E-06	NA	mr1148	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	3.88E-06	3.88E-06	mr1165	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	4.56E-45	mr1200	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	1.51E-30	mr1204	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	4.34E-52	mr1211	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	2.72E-28	mr1221	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	2.21E-30	mr1237	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	9.30E-44	mr1526	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	8.75E-07	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	1.80E-63	mr1065_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	1.11E-55	mr1067_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	1.16E-67	mr1068_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	5.06E-70	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	1.89E-64	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	8.29E-51	mr1111_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	1.49E-50	mr1144_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	4.90E-10	6.89E-11	mr1165_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	1.72E-56	mr1200_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	1.36E-59	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	1.50E-08	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	1.27E-13	mr1326_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	1.85E-06	1.85E-06	mr1477_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	NA	2.35E-58	mr1526_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611357651	8.03E-07	8.03E-07	mr1971_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251