Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611311887:

Variant ID: vg0611311887 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 11311887
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, G: 0.20, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

CAATATTTGAGAGTGCATTATGTGTTCTGTGTTTTCTCTATGTTGTTGACATATTTGGAAAAACTACATAAATTATTTCTACATGGACCATGAACTGTAG[G/A]
GGAACTCGGAATAGTCTGGGTGTCATATGGCCCAAAAGTGAAACTACACAATTAGTTCCCCACAGAACATAAGAAATAAATATACATAAACGAAGATGAT

Reverse complement sequence

ATCATCTTCGTTTATGTATATTTATTTCTTATGTTCTGTGGGGAACTAATTGTGTAGTTTCACTTTTGGGCCATATGACACCCAGACTATTCCGAGTTCC[C/T]
CTACAGTTCATGGTCCATGTAGAAATAATTTATGTAGTTTTTCCAAATATGTCAACAACATAGAGAAAACACAGAACACATAATGCACTCTCAAATATTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.10%	10.30%	0.95%	51.65%	NA
All Indica	2759	3.40%	10.00%	1.45%	85.14%	NA
All Japonica	1512	88.30%	8.40%	0.13%	3.17%	NA
Aus	269	74.00%	25.70%	0.00%	0.37%	NA
Indica I	595	3.50%	10.30%	1.51%	84.71%	NA
Indica II	465	3.20%	1.90%	2.15%	92.69%	NA
Indica III	913	1.20%	11.90%	1.10%	85.76%	NA
Indica Intermediate	786	6.00%	12.30%	1.40%	80.28%	NA
Temperate Japonica	767	95.70%	0.40%	0.26%	3.65%	NA
Tropical Japonica	504	75.00%	23.80%	0.00%	1.19%	NA
Japonica Intermediate	241	92.50%	1.70%	0.00%	5.81%	NA
VI/Aromatic	96	83.30%	3.10%	0.00%	13.54%	NA
Intermediate	90	50.00%	13.30%	3.33%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0611311887	G -> A	LOC_Os06g19800.1	intron_variant ; MODIFIER	silent_mutation	Average:8.114; most accessible tissue: Callus, score: 44.585	N	N	N	N
vg0611311887	G -> DEL	N	N	silent_mutation	Average:8.114; most accessible tissue: Callus, score: 44.585	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0611311887	2.23E-07	2.23E-07	mr1032	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	4.33E-06	1.08E-59	mr1065	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	1.12E-57	mr1068	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	2.79E-54	mr1078	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	2.36E-06	4.79E-61	mr1087	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	2.74E-07	3.71E-60	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	3.56E-38	mr1091	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	6.39E-36	mr1094	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	2.25E-50	mr1096	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	4.56E-45	mr1108	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	1.95E-35	mr1110	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	1.50E-48	mr1111	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	8.64E-46	mr1112	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	1.25E-51	mr1121	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	2.06E-07	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	4.63E-47	mr1144	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	7.56E-08	7.56E-08	mr1165	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	1.27E-44	mr1200	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	3.11E-54	mr1211	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	4.30E-31	mr1237	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	3.20E-09	3.20E-09	mr1478	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	5.76E-44	mr1526	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	7.71E-06	mr1780	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	3.78E-06	NA	mr1971	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	1.27E-63	mr1065_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	1.66E-70	mr1068_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	4.09E-10	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	8.42E-64	mr1078_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	4.34E-67	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	5.29E-46	mr1094_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	1.59E-60	mr1096_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	1.26E-07	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	5.80E-53	mr1111_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	4.63E-08	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	2.49E-06	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	2.51E-54	mr1144_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	1.49E-07	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	1.49E-11	3.21E-13	mr1165_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	1.95E-59	mr1200_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	5.37E-10	mr1200_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	5.07E-61	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	1.73E-07	1.73E-07	mr1477_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	1.19E-15	mr1686_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	NA	8.18E-22	mr1877_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611311887	1.37E-08	1.37E-08	mr1971_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251