\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611290898:

Variant ID: vg0611290898 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11290898
Reference Allele: CAlternative Allele: A,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, C: 0.31, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGTTACTCTGCAAATGCTTTCCAACTATAGTAAAAAAATTATTAATTGAATAATCAAAATTTCAGTCTTTGATCGATGAGTATAGCAAAATGCACATG[C/A,T]
GTCAACTTATGGAATGGCCACCCGATTGATTTGTGAAGCTATGGAAAGACGTACATAAGTGATTCTTCGTGTGATGACACATGAAGCACGCACAACCCGG

Reverse complement sequence

CCGGGTTGTGCGTGCTTCATGTGTCATCACACGAAGAATCACTTATGTACGTCTTTCCATAGCTTCACAAATCAATCGGGTGGCCATTCCATAAGTTGAC[G/T,A]
CATGTGCATTTTGCTATACTCATCGATCAAAGACTGAAATTTTGATTATTCAATTAATAATTTTTTTACTATAGTTGGAAAGCATTTGCAGAGTAACAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.50% 43.30% 0.19% 0.00% T: 0.04%
All Indica  2759 85.90% 13.90% 0.14% 0.00% T: 0.07%
All Japonica  1512 11.40% 88.40% 0.20% 0.00% NA
Aus  269 26.00% 74.00% 0.00% 0.00% NA
Indica I  595 98.30% 1.50% 0.17% 0.00% NA
Indica II  465 96.60% 3.00% 0.00% 0.00% T: 0.43%
Indica III  913 70.60% 29.20% 0.11% 0.00% NA
Indica Intermediate  786 87.80% 12.00% 0.25% 0.00% NA
Temperate Japonica  767 3.90% 96.00% 0.13% 0.00% NA
Tropical Japonica  504 25.00% 74.80% 0.20% 0.00% NA
Japonica Intermediate  241 6.60% 92.90% 0.41% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 48.90% 48.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611290898 C -> T LOC_Os06g19750.1 downstream_gene_variant ; 1750.0bp to feature; MODIFIER silent_mutation Average:41.525; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0611290898 C -> T LOC_Os06g19740.1 intron_variant ; MODIFIER silent_mutation Average:41.525; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0611290898 C -> A LOC_Os06g19750.1 downstream_gene_variant ; 1750.0bp to feature; MODIFIER silent_mutation Average:41.525; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0611290898 C -> A LOC_Os06g19740.1 intron_variant ; MODIFIER silent_mutation Average:41.525; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611290898 NA 1.37E-54 mr1065 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611290898 NA 4.89E-53 mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611290898 NA 2.31E-41 mr1200 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611290898 4.43E-06 5.19E-07 mr1245 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611290898 NA 1.97E-65 mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611290898 NA 1.41E-62 mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611290898 NA 1.16E-52 mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611290898 NA 2.89E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611290898 NA 2.07E-52 mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611290898 NA 8.08E-19 mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611290898 1.11E-09 4.31E-11 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611290898 NA 1.87E-55 mr1200_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611290898 NA 2.32E-08 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611290898 NA 1.00E-56 mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611290898 NA 1.57E-16 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611290898 7.68E-07 7.68E-07 mr1477_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611290898 NA 6.19E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611290898 4.91E-07 4.91E-07 mr1971_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251