\
| Variant ID: vg0611197637 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11197637 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGCTTGCAAACCTTAACATAGGCTAGCTTATTTGTGCACTTACTTGAGACTAGTTGATTTAGGTTTTGAATTGTGCAAAACCGTTTTGATTTACACTTCC[G/A,T]
CATACAAAACTCGGTTTTAGCCAAAAGTTTTAAAACCGCCTATTCACCCCCCCCCCCAGTTAGCCTCCTTGATCCTACAGTACTCTACATGAATTGGTTA
TAACCAATTCATGTAGAGTACTGTAGGATCAAGGAGGCTAACTGGGGGGGGGGGTGAATAGGCGGTTTTAAAACTTTTGGCTAAAACCGAGTTTTGTATG[C/T,A]
GGAAGTGTAAATCAAAACGGTTTTGCACAATTCAAAACCTAAATCAACTAGTCTCAAGTAAGTGCACAAATAAGCTAGCCTATGTTAAGGTTTGCAAGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.60% | 3.30% | 5.86% | 15.26% | NA |
| All Indica | 2759 | 60.00% | 5.60% | 9.53% | 24.90% | NA |
| All Japonica | 1512 | 98.10% | 0.00% | 0.46% | 1.46% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 22.70% | 11.30% | 15.80% | 50.25% | NA |
| Indica II | 465 | 93.30% | 0.20% | 1.08% | 5.38% | NA |
| Indica III | 913 | 70.10% | 4.60% | 7.89% | 17.42% | NA |
| Indica Intermediate | 786 | 56.70% | 5.60% | 11.70% | 25.95% | NA |
| Temperate Japonica | 767 | 97.70% | 0.00% | 0.78% | 1.56% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.00% | 0.00% | 3.32% | NA |
| VI/Aromatic | 96 | 90.60% | 0.00% | 4.17% | 5.21% | NA |
| Intermediate | 90 | 87.80% | 1.10% | 3.33% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611197637 | G -> T | LOC_Os06g19630.2 | downstream_gene_variant ; 2495.0bp to feature; MODIFIER | N | Average:30.93; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| vg0611197637 | G -> T | LOC_Os06g19630.1 | downstream_gene_variant ; 2495.0bp to feature; MODIFIER | N | Average:30.93; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| vg0611197637 | G -> T | LOC_Os06g19620-LOC_Os06g19630 | intergenic_region ; MODIFIER | N | Average:30.93; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| vg0611197637 | G -> A | LOC_Os06g19630.2 | downstream_gene_variant ; 2495.0bp to feature; MODIFIER | silent_mutation | Average:30.93; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| vg0611197637 | G -> A | LOC_Os06g19630.1 | downstream_gene_variant ; 2495.0bp to feature; MODIFIER | silent_mutation | Average:30.93; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| vg0611197637 | G -> A | LOC_Os06g19620-LOC_Os06g19630 | intergenic_region ; MODIFIER | silent_mutation | Average:30.93; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| vg0611197637 | G -> DEL | N | N | silent_mutation | Average:30.93; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611197637 | NA | 1.00E-07 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611197637 | NA | 1.35E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611197637 | NA | 7.18E-08 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611197637 | NA | 3.14E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611197637 | 3.18E-06 | 1.12E-06 | mr1538 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611197637 | 2.14E-06 | NA | mr1547 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611197637 | 2.63E-06 | NA | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611197637 | NA | 1.64E-06 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611197637 | NA | 1.60E-06 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611197637 | 5.79E-06 | NA | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |