\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611197637:

Variant ID: vg0611197637 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11197637
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCTTGCAAACCTTAACATAGGCTAGCTTATTTGTGCACTTACTTGAGACTAGTTGATTTAGGTTTTGAATTGTGCAAAACCGTTTTGATTTACACTTCC[G/A,T]
CATACAAAACTCGGTTTTAGCCAAAAGTTTTAAAACCGCCTATTCACCCCCCCCCCCAGTTAGCCTCCTTGATCCTACAGTACTCTACATGAATTGGTTA

Reverse complement sequence

TAACCAATTCATGTAGAGTACTGTAGGATCAAGGAGGCTAACTGGGGGGGGGGGTGAATAGGCGGTTTTAAAACTTTTGGCTAAAACCGAGTTTTGTATG[C/T,A]
GGAAGTGTAAATCAAAACGGTTTTGCACAATTCAAAACCTAAATCAACTAGTCTCAAGTAAGTGCACAAATAAGCTAGCCTATGTTAAGGTTTGCAAGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.60% 3.30% 5.86% 15.26% NA
All Indica  2759 60.00% 5.60% 9.53% 24.90% NA
All Japonica  1512 98.10% 0.00% 0.46% 1.46% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 22.70% 11.30% 15.80% 50.25% NA
Indica II  465 93.30% 0.20% 1.08% 5.38% NA
Indica III  913 70.10% 4.60% 7.89% 17.42% NA
Indica Intermediate  786 56.70% 5.60% 11.70% 25.95% NA
Temperate Japonica  767 97.70% 0.00% 0.78% 1.56% NA
Tropical Japonica  504 99.40% 0.00% 0.20% 0.40% NA
Japonica Intermediate  241 96.70% 0.00% 0.00% 3.32% NA
VI/Aromatic  96 90.60% 0.00% 4.17% 5.21% NA
Intermediate  90 87.80% 1.10% 3.33% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611197637 G -> T LOC_Os06g19630.2 downstream_gene_variant ; 2495.0bp to feature; MODIFIER N Average:30.93; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0611197637 G -> T LOC_Os06g19630.1 downstream_gene_variant ; 2495.0bp to feature; MODIFIER N Average:30.93; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0611197637 G -> T LOC_Os06g19620-LOC_Os06g19630 intergenic_region ; MODIFIER N Average:30.93; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0611197637 G -> A LOC_Os06g19630.2 downstream_gene_variant ; 2495.0bp to feature; MODIFIER silent_mutation Average:30.93; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0611197637 G -> A LOC_Os06g19630.1 downstream_gene_variant ; 2495.0bp to feature; MODIFIER silent_mutation Average:30.93; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0611197637 G -> A LOC_Os06g19620-LOC_Os06g19630 intergenic_region ; MODIFIER silent_mutation Average:30.93; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0611197637 G -> DEL N N silent_mutation Average:30.93; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611197637 NA 1.00E-07 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197637 NA 1.35E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197637 NA 7.18E-08 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197637 NA 3.14E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197637 3.18E-06 1.12E-06 mr1538 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197637 2.14E-06 NA mr1547 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197637 2.63E-06 NA mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197637 NA 1.64E-06 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197637 NA 1.60E-06 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197637 5.79E-06 NA mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251