\
| Variant ID: vg0611197335 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11197335 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGCGCCGGTTGTGAGTGGTTTGGAGTTCACCACCTTCGGAGTGAAGGAAGAACTACCCTTGTGATCGAGGCTTGGGTAGTCCTCTCCATGGGCCGGCTCC[C/T]
ACCTTACCCACCCCTTGATGAAGGGGGCGTGCGGTGGCTTCGTGGTTGAGCGGTGGAGTTGGGCTCGCCTCAACGGGGATTAGGAAACCGGCGAGTTTCC
GGAAACTCGCCGGTTTCCTAATCCCCGTTGAGGCGAGCCCAACTCCACCGCTCAACCACGAAGCCACCGCACGCCCCCTTCATCAAGGGGTGGGTAAGGT[G/A]
GGAGCCGGCCCATGGAGAGGACTACCCAAGCCTCGATCACAAGGGTAGTTCTTCCTTCACTCCGAAGGTGGTGAACTCCAAACCACTCACAACCGGCGCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.10% | 2.50% | 4.87% | 17.48% | NA |
| All Indica | 2759 | 59.10% | 4.30% | 8.08% | 28.49% | NA |
| All Japonica | 1512 | 98.10% | 0.00% | 0.07% | 1.85% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 22.00% | 10.10% | 9.92% | 57.98% | NA |
| Indica II | 465 | 90.50% | 0.60% | 3.23% | 5.59% | NA |
| Indica III | 913 | 68.80% | 2.70% | 8.87% | 19.61% | NA |
| Indica Intermediate | 786 | 57.40% | 3.90% | 8.65% | 30.03% | NA |
| Temperate Japonica | 767 | 97.70% | 0.00% | 0.13% | 2.22% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.00% | 0.00% | 3.32% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 2.08% | 5.21% | NA |
| Intermediate | 90 | 86.70% | 1.10% | 4.44% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611197335 | C -> T | LOC_Os06g19630.2 | downstream_gene_variant ; 2797.0bp to feature; MODIFIER | silent_mutation | Average:32.276; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| vg0611197335 | C -> T | LOC_Os06g19630.1 | downstream_gene_variant ; 2797.0bp to feature; MODIFIER | silent_mutation | Average:32.276; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| vg0611197335 | C -> T | LOC_Os06g19620-LOC_Os06g19630 | intergenic_region ; MODIFIER | silent_mutation | Average:32.276; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| vg0611197335 | C -> DEL | N | N | silent_mutation | Average:32.276; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611197335 | NA | 2.58E-09 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611197335 | NA | 9.69E-10 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611197335 | NA | 1.76E-06 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611197335 | 5.63E-06 | 5.63E-06 | mr1544 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611197335 | 4.88E-08 | 2.18E-07 | mr1547 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611197335 | NA | 3.99E-07 | mr1743 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611197335 | NA | 9.40E-08 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |