\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611197335:

Variant ID: vg0611197335 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11197335
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCGCCGGTTGTGAGTGGTTTGGAGTTCACCACCTTCGGAGTGAAGGAAGAACTACCCTTGTGATCGAGGCTTGGGTAGTCCTCTCCATGGGCCGGCTCC[C/T]
ACCTTACCCACCCCTTGATGAAGGGGGCGTGCGGTGGCTTCGTGGTTGAGCGGTGGAGTTGGGCTCGCCTCAACGGGGATTAGGAAACCGGCGAGTTTCC

Reverse complement sequence

GGAAACTCGCCGGTTTCCTAATCCCCGTTGAGGCGAGCCCAACTCCACCGCTCAACCACGAAGCCACCGCACGCCCCCTTCATCAAGGGGTGGGTAAGGT[G/A]
GGAGCCGGCCCATGGAGAGGACTACCCAAGCCTCGATCACAAGGGTAGTTCTTCCTTCACTCCGAAGGTGGTGAACTCCAAACCACTCACAACCGGCGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.10% 2.50% 4.87% 17.48% NA
All Indica  2759 59.10% 4.30% 8.08% 28.49% NA
All Japonica  1512 98.10% 0.00% 0.07% 1.85% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 22.00% 10.10% 9.92% 57.98% NA
Indica II  465 90.50% 0.60% 3.23% 5.59% NA
Indica III  913 68.80% 2.70% 8.87% 19.61% NA
Indica Intermediate  786 57.40% 3.90% 8.65% 30.03% NA
Temperate Japonica  767 97.70% 0.00% 0.13% 2.22% NA
Tropical Japonica  504 99.40% 0.00% 0.00% 0.60% NA
Japonica Intermediate  241 96.70% 0.00% 0.00% 3.32% NA
VI/Aromatic  96 92.70% 0.00% 2.08% 5.21% NA
Intermediate  90 86.70% 1.10% 4.44% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611197335 C -> T LOC_Os06g19630.2 downstream_gene_variant ; 2797.0bp to feature; MODIFIER silent_mutation Average:32.276; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N
vg0611197335 C -> T LOC_Os06g19630.1 downstream_gene_variant ; 2797.0bp to feature; MODIFIER silent_mutation Average:32.276; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N
vg0611197335 C -> T LOC_Os06g19620-LOC_Os06g19630 intergenic_region ; MODIFIER silent_mutation Average:32.276; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N
vg0611197335 C -> DEL N N silent_mutation Average:32.276; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611197335 NA 2.58E-09 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197335 NA 9.69E-10 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197335 NA 1.76E-06 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197335 5.63E-06 5.63E-06 mr1544 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197335 4.88E-08 2.18E-07 mr1547 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197335 NA 3.99E-07 mr1743 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197335 NA 9.40E-08 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251