\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611181245:

Variant ID: vg0611181245 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11181245
Reference Allele: CAlternative Allele: G,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAGGCCGCGCCCCGCGAGCTCCAGCGCCATGGCACGGCCGATGCCTGACGTCGGCCCGGTGACGACGGCCCACGAGCCGTACCGGCGGCGGAGGTCCCC[C/G,T]
CTGGGACGGGCGCGCAGGCCGAACGTGAGGGTGGCGACGAGTCGGAGGACGTCGGCGGCGACATGGACGGCGCCGAGGGAGGCCAGCAGGATGAGCCATA

Reverse complement sequence

TATGGCTCATCCTGCTGGCCTCCCTCGGCGCCGTCCATGTCGCCGCCGACGTCCTCCGACTCGTCGCCACCCTCACGTTCGGCCTGCGCGCCCGTCCCAG[G/C,A]
GGGGACCTCCGCCGCCGGTACGGCTCGTGGGCCGTCGTCACCGGGCCGACGTCAGGCATCGGCCGTGCCATGGCGCTGGAGCTCGCGGGGCGCGGCCTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.20% 5.20% 0.99% 23.55% T: 0.04%
All Indica  2759 51.10% 8.50% 1.63% 38.71% T: 0.04%
All Japonica  1512 97.70% 0.50% 0.07% 1.79% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 25.70% 0.00% 2.18% 72.10% NA
Indica II  465 80.40% 9.50% 2.37% 7.74% NA
Indica III  913 57.00% 13.30% 0.77% 29.03% NA
Indica Intermediate  786 46.20% 8.90% 1.78% 43.00% T: 0.13%
Temperate Japonica  767 97.10% 0.70% 0.13% 2.09% NA
Tropical Japonica  504 99.40% 0.00% 0.00% 0.60% NA
Japonica Intermediate  241 95.90% 0.80% 0.00% 3.32% NA
VI/Aromatic  96 92.70% 0.00% 0.00% 7.29% NA
Intermediate  90 78.90% 6.70% 1.11% 12.22% T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611181245 C -> G LOC_Os06g19610.1 missense_variant ; p.Arg36Ser; MODERATE nonsynonymous_codon ; R36S Average:79.444; most accessible tissue: Zhenshan97 panicle, score: 91.374 unknown unknown TOLERATED 0.60
vg0611181245 C -> T LOC_Os06g19610.1 synonymous_variant ; p.Arg36Arg; LOW synonymous_codon Average:79.444; most accessible tissue: Zhenshan97 panicle, score: 91.374 N N N N
vg0611181245 C -> DEL LOC_Os06g19610.1 N frameshift_variant Average:79.444; most accessible tissue: Zhenshan97 panicle, score: 91.374 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0611181245 C G -0.03 -0.04 -0.04 -0.05 -0.04 -0.04
vg0611181245 C T -0.04 -0.04 -0.04 -0.06 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611181245 NA 1.62E-09 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611181245 NA 2.07E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611181245 NA 3.63E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611181245 NA 5.62E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611181245 NA 2.01E-10 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611181245 NA 1.89E-08 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611181245 NA 4.16E-07 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611181245 NA 2.98E-09 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611181245 4.83E-06 3.62E-07 mr1946_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611181245 4.83E-06 3.62E-07 mr1948_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251