\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611159825:

Variant ID: vg0611159825 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11159825
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TTATGCACGAAGATGACTTTTTTAACTTTATTTTTGCATCATCACACTCTACATAACACTATTATATGATGATTAATTATATGATAATAAGTTTAATGAA[C/T,A]
AATATAAACAAAGTTCAACAATACTACAACATCGATTAGTTGAGGAGACCAAAGTTCAGGAAAATCCACATGCCACGTCATAGGATTAACAACATTTTCC

Reverse complement sequence

GGAAAATGTTGTTAATCCTATGACGTGGCATGTGGATTTTCCTGAACTTTGGTCTCCTCAACTAATCGATGTTGTAGTATTGTTGAACTTTGTTTATATT[G/A,T]
TTCATTAAACTTATTATCATATAATTAATCATCATATAATAGTGTTATGTAGAGTGTGATGATGCAAAAATAAAGTTAAAAAAGTCATCTTCGTGCATAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.80% 28.90% 0.11% 0.00% A: 0.21%
All Indica  2759 97.60% 1.90% 0.14% 0.00% A: 0.36%
All Japonica  1512 33.70% 66.20% 0.07% 0.00% NA
Aus  269 26.00% 74.00% 0.00% 0.00% NA
Indica I  595 99.00% 0.70% 0.34% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 97.60% 1.20% 0.11% 0.00% A: 1.10%
Indica Intermediate  786 96.30% 3.60% 0.13% 0.00% NA
Temperate Japonica  767 41.10% 58.90% 0.00% 0.00% NA
Tropical Japonica  504 26.60% 73.40% 0.00% 0.00% NA
Japonica Intermediate  241 25.30% 74.30% 0.41% 0.00% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 63.30% 36.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611159825 C -> T LOC_Os06g19580.1 downstream_gene_variant ; 4938.0bp to feature; MODIFIER silent_mutation Average:47.832; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N
vg0611159825 C -> T LOC_Os06g19580-LOC_Os06g19590 intergenic_region ; MODIFIER silent_mutation Average:47.832; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N
vg0611159825 C -> A LOC_Os06g19580.1 downstream_gene_variant ; 4938.0bp to feature; MODIFIER silent_mutation Average:47.832; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N
vg0611159825 C -> A LOC_Os06g19580-LOC_Os06g19590 intergenic_region ; MODIFIER silent_mutation Average:47.832; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611159825 NA 7.09E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611159825 NA 7.17E-11 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611159825 NA 4.44E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611159825 9.05E-06 1.20E-19 mr1261 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611159825 NA 1.58E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611159825 NA 4.05E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611159825 NA 6.17E-08 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611159825 NA 4.30E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611159825 NA 7.56E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611159825 NA 1.14E-12 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611159825 NA 8.69E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611159825 NA 6.51E-15 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611159825 NA 2.73E-06 mr1341_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611159825 NA 2.63E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611159825 NA 2.73E-31 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611159825 NA 5.18E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611159825 NA 4.00E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611159825 NA 1.11E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611159825 NA 1.73E-29 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611159825 NA 6.74E-08 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251