| Variant ID: vg0611158301 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11158301 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 117. )
TGCGGTCCAATCAAATAGTCATTTATGTGTTTTTCCTGTATTTTGCAATCCTCTATTTTTACCCTTGTATTCATATCAAAATCCTGCGTTTTTTCTATTC[A/G]
TATGTTTTTTCAATCCTGTGATTCAAATGGTCCCTTAGGGTTTATAATTAATCTAGTATTTTACTGGTTTGACTTATTAACTTAAGTGATAATATTTGAC
GTCAAATATTATCACTTAAGTTAATAAGTCAAACCAGTAAAATACTAGATTAATTATAAACCCTAAGGGACCATTTGAATCACAGGATTGAAAAAACATA[T/C]
GAATAGAAAAAACGCAGGATTTTGATATGAATACAAGGGTAAAAATAGAGGATTGCAAAATACAGGAAAAACACATAAATGACTATTTGATTGGACCGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.90% | 10.10% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 94.90% | 5.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 78.20% | 21.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.60% | 9.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 63.50% | 36.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.60% | 17.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611158301 | A -> G | LOC_Os06g19580.1 | downstream_gene_variant ; 3414.0bp to feature; MODIFIER | silent_mutation | Average:32.527; most accessible tissue: Callus, score: 56.385 | N | N | N | N |
| vg0611158301 | A -> G | LOC_Os06g19580-LOC_Os06g19590 | intergenic_region ; MODIFIER | silent_mutation | Average:32.527; most accessible tissue: Callus, score: 56.385 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611158301 | 8.09E-06 | NA | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611158301 | 4.28E-07 | NA | mr1563 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611158301 | NA | 9.46E-07 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611158301 | 4.63E-07 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611158301 | NA | 6.21E-07 | mr1161_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611158301 | NA | 4.78E-06 | mr1693_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |