\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611158301:

Variant ID: vg0611158301 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11158301
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TGCGGTCCAATCAAATAGTCATTTATGTGTTTTTCCTGTATTTTGCAATCCTCTATTTTTACCCTTGTATTCATATCAAAATCCTGCGTTTTTTCTATTC[A/G]
TATGTTTTTTCAATCCTGTGATTCAAATGGTCCCTTAGGGTTTATAATTAATCTAGTATTTTACTGGTTTGACTTATTAACTTAAGTGATAATATTTGAC

Reverse complement sequence

GTCAAATATTATCACTTAAGTTAATAAGTCAAACCAGTAAAATACTAGATTAATTATAAACCCTAAGGGACCATTTGAATCACAGGATTGAAAAAACATA[T/C]
GAATAGAAAAAACGCAGGATTTTGATATGAATACAAGGGTAAAAATAGAGGATTGCAAAATACAGGAAAAACACATAAATGACTATTTGATTGGACCGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 10.10% 0.04% 0.00% NA
All Indica  2759 94.90% 5.10% 0.04% 0.00% NA
All Japonica  1512 78.20% 21.80% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 90.60% 9.30% 0.11% 0.00% NA
Indica Intermediate  786 94.80% 5.20% 0.00% 0.00% NA
Temperate Japonica  767 63.50% 36.50% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 82.60% 17.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611158301 A -> G LOC_Os06g19580.1 downstream_gene_variant ; 3414.0bp to feature; MODIFIER silent_mutation Average:32.527; most accessible tissue: Callus, score: 56.385 N N N N
vg0611158301 A -> G LOC_Os06g19580-LOC_Os06g19590 intergenic_region ; MODIFIER silent_mutation Average:32.527; most accessible tissue: Callus, score: 56.385 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611158301 8.09E-06 NA mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611158301 4.28E-07 NA mr1563 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611158301 NA 9.46E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611158301 4.63E-07 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611158301 NA 6.21E-07 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611158301 NA 4.78E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251