\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611148454:

Variant ID: vg0611148454 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11148454
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.18, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


ATGATTCTAAGCACAGCTAGGAATGATGCATCGCGGAGTATGCAAAGAAGCATAAAGTCTAAACAATCAAGCATTTGACTAATTTTTAGGGTGGTGAATA[T/C]
CTTAGTTAATTTAATCTAGCTAGATAATTTAGCCAATACTAACATAGACCCTAAAATGAATCTCAGCTGATATGATCAAATTAAGATTCTAAACTAGATT

Reverse complement sequence

AATCTAGTTTAGAATCTTAATTTGATCATATCAGCTGAGATTCATTTTAGGGTCTATGTTAGTATTGGCTAAATTATCTAGCTAGATTAAATTAACTAAG[A/G]
TATTCACCACCCTAAAAATTAGTCAAATGCTTGATTGTTTAGACTTTATGCTTCTTTGCATACTCCGCGATGCATCATTCCTAGCTGTGCTTAGAATCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 8.70% 0.25% 23.02% NA
All Indica  2759 61.20% 0.50% 0.40% 37.91% NA
All Japonica  1512 72.00% 26.20% 0.07% 1.72% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 28.10% 0.50% 0.84% 70.59% NA
Indica II  465 93.30% 0.00% 0.00% 6.67% NA
Indica III  913 70.90% 0.20% 0.22% 28.70% NA
Indica Intermediate  786 56.10% 1.00% 0.51% 42.37% NA
Temperate Japonica  767 54.40% 43.50% 0.13% 1.96% NA
Tropical Japonica  504 97.20% 2.20% 0.00% 0.60% NA
Japonica Intermediate  241 75.50% 21.20% 0.00% 3.32% NA
VI/Aromatic  96 92.70% 0.00% 0.00% 7.29% NA
Intermediate  90 85.60% 4.40% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611148454 T -> C LOC_Os06g19570.1 downstream_gene_variant ; 3559.0bp to feature; MODIFIER silent_mutation Average:30.921; most accessible tissue: Callus, score: 68.807 N N N N
vg0611148454 T -> C LOC_Os06g19570-LOC_Os06g19580 intergenic_region ; MODIFIER silent_mutation Average:30.921; most accessible tissue: Callus, score: 68.807 N N N N
vg0611148454 T -> DEL N N silent_mutation Average:30.921; most accessible tissue: Callus, score: 68.807 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611148454 9.76E-07 1.06E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611148454 3.75E-06 1.60E-10 mr1570 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611148454 NA 2.77E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611148454 NA 1.99E-09 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611148454 NA 2.14E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611148454 NA 6.76E-07 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611148454 NA 2.69E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611148454 NA 2.27E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611148454 NA 5.77E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611148454 NA 9.15E-11 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611148454 NA 5.19E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611148454 NA 3.23E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611148454 NA 1.22E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251