\
| Variant ID: vg0611148454 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11148454 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.18, others allele: 0.00, population size: 105. )
ATGATTCTAAGCACAGCTAGGAATGATGCATCGCGGAGTATGCAAAGAAGCATAAAGTCTAAACAATCAAGCATTTGACTAATTTTTAGGGTGGTGAATA[T/C]
CTTAGTTAATTTAATCTAGCTAGATAATTTAGCCAATACTAACATAGACCCTAAAATGAATCTCAGCTGATATGATCAAATTAAGATTCTAAACTAGATT
AATCTAGTTTAGAATCTTAATTTGATCATATCAGCTGAGATTCATTTTAGGGTCTATGTTAGTATTGGCTAAATTATCTAGCTAGATTAAATTAACTAAG[A/G]
TATTCACCACCCTAAAAATTAGTCAAATGCTTGATTGTTTAGACTTTATGCTTCTTTGCATACTCCGCGATGCATCATTCCTAGCTGTGCTTAGAATCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.00% | 8.70% | 0.25% | 23.02% | NA |
| All Indica | 2759 | 61.20% | 0.50% | 0.40% | 37.91% | NA |
| All Japonica | 1512 | 72.00% | 26.20% | 0.07% | 1.72% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 28.10% | 0.50% | 0.84% | 70.59% | NA |
| Indica II | 465 | 93.30% | 0.00% | 0.00% | 6.67% | NA |
| Indica III | 913 | 70.90% | 0.20% | 0.22% | 28.70% | NA |
| Indica Intermediate | 786 | 56.10% | 1.00% | 0.51% | 42.37% | NA |
| Temperate Japonica | 767 | 54.40% | 43.50% | 0.13% | 1.96% | NA |
| Tropical Japonica | 504 | 97.20% | 2.20% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 75.50% | 21.20% | 0.00% | 3.32% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 85.60% | 4.40% | 0.00% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611148454 | T -> C | LOC_Os06g19570.1 | downstream_gene_variant ; 3559.0bp to feature; MODIFIER | silent_mutation | Average:30.921; most accessible tissue: Callus, score: 68.807 | N | N | N | N |
| vg0611148454 | T -> C | LOC_Os06g19570-LOC_Os06g19580 | intergenic_region ; MODIFIER | silent_mutation | Average:30.921; most accessible tissue: Callus, score: 68.807 | N | N | N | N |
| vg0611148454 | T -> DEL | N | N | silent_mutation | Average:30.921; most accessible tissue: Callus, score: 68.807 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611148454 | 9.76E-07 | 1.06E-08 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611148454 | 3.75E-06 | 1.60E-10 | mr1570 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611148454 | NA | 2.77E-06 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611148454 | NA | 1.99E-09 | mr1087_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611148454 | NA | 2.14E-07 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611148454 | NA | 6.76E-07 | mr1161_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611148454 | NA | 2.69E-07 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611148454 | NA | 2.27E-07 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611148454 | NA | 5.77E-06 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611148454 | NA | 9.15E-11 | mr1570_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611148454 | NA | 5.19E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611148454 | NA | 3.23E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611148454 | NA | 1.22E-07 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |