Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611142895:

Variant ID: vg0611142895 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 11142895
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

TAGATTTATCATTAAACAAACTATTATAATATGCAACTCTTTTTATTGAAAACATCTTAATTTTATAGATATTGATGGTCAAAGTAGCATCTCGGAGATC[G/A]
TGTCAGGGTCAAAATGCTTATATTTTGAGATTGAGGGAGTATATGATATGGTCAGCATAAAACCCAAAATGAAAAATTCAAGCATGCGCAATGTGCAAGT

Reverse complement sequence

ACTTGCACATTGCGCATGCTTGAATTTTTCATTTTGGGTTTTATGCTGACCATATCATATACTCCCTCAATCTCAAAATATAAGCATTTTGACCCTGACA[C/T]
GATCTCCGAGATGCTACTTTGACCATCAATATCTATAAAATTAAGATGTTTTCAATAAAAAGAGTTGCATATTATAATAGTTTGTTTAATGATAAATCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.90%	29.00%	0.78%	22.34%	NA
All Indica	2759	59.90%	2.10%	1.01%	36.90%	NA
All Japonica	1512	36.40%	61.70%	0.40%	1.52%	NA
Aus	269	2.20%	97.80%	0.00%	0.00%	NA
Indica I	595	28.20%	0.80%	1.85%	69.08%	NA
Indica II	465	91.00%	1.90%	0.65%	6.45%	NA
Indica III	913	70.00%	1.30%	0.33%	28.37%	NA
Indica Intermediate	786	53.90%	4.20%	1.40%	40.46%	NA
Temperate Japonica	767	45.80%	52.00%	0.65%	1.56%	NA
Tropical Japonica	504	27.20%	72.20%	0.00%	0.60%	NA
Japonica Intermediate	241	25.70%	70.50%	0.41%	3.32%	NA
VI/Aromatic	96	7.30%	85.40%	1.04%	6.25%	NA
Intermediate	90	50.00%	37.80%	2.22%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0611142895	G -> A	LOC_Os06g19570.1	upstream_gene_variant ; 576.0bp to feature; MODIFIER	silent_mutation	Average:25.407; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0611142895	G -> A	LOC_Os06g19550-LOC_Os06g19570	intergenic_region ; MODIFIER	silent_mutation	Average:25.407; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0611142895	G -> DEL	N	N	silent_mutation	Average:25.407; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0611142895	NA	1.03E-32	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	1.50E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	2.64E-10	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	6.35E-34	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	1.25E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	2.31E-17	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	4.30E-14	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	4.66E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	3.26E-07	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	1.94E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	5.84E-12	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	3.47E-07	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	1.56E-33	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	5.01E-10	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	7.61E-16	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	2.58E-15	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	6.50E-18	mr1260_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	9.19E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	1.19E-06	mr1341_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	1.44E-12	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	8.84E-25	mr1531_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	4.17E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	1.33E-35	mr1580_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	2.77E-10	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	1.57E-10	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	4.41E-10	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	9.89E-34	mr1825_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895	NA	4.30E-07	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251