\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611142895:

Variant ID: vg0611142895 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11142895
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


TAGATTTATCATTAAACAAACTATTATAATATGCAACTCTTTTTATTGAAAACATCTTAATTTTATAGATATTGATGGTCAAAGTAGCATCTCGGAGATC[G/A]
TGTCAGGGTCAAAATGCTTATATTTTGAGATTGAGGGAGTATATGATATGGTCAGCATAAAACCCAAAATGAAAAATTCAAGCATGCGCAATGTGCAAGT

Reverse complement sequence

ACTTGCACATTGCGCATGCTTGAATTTTTCATTTTGGGTTTTATGCTGACCATATCATATACTCCCTCAATCTCAAAATATAAGCATTTTGACCCTGACA[C/T]
GATCTCCGAGATGCTACTTTGACCATCAATATCTATAAAATTAAGATGTTTTCAATAAAAAGAGTTGCATATTATAATAGTTTGTTTAATGATAAATCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.90% 29.00% 0.78% 22.34% NA
All Indica  2759 59.90% 2.10% 1.01% 36.90% NA
All Japonica  1512 36.40% 61.70% 0.40% 1.52% NA
Aus  269 2.20% 97.80% 0.00% 0.00% NA
Indica I  595 28.20% 0.80% 1.85% 69.08% NA
Indica II  465 91.00% 1.90% 0.65% 6.45% NA
Indica III  913 70.00% 1.30% 0.33% 28.37% NA
Indica Intermediate  786 53.90% 4.20% 1.40% 40.46% NA
Temperate Japonica  767 45.80% 52.00% 0.65% 1.56% NA
Tropical Japonica  504 27.20% 72.20% 0.00% 0.60% NA
Japonica Intermediate  241 25.70% 70.50% 0.41% 3.32% NA
VI/Aromatic  96 7.30% 85.40% 1.04% 6.25% NA
Intermediate  90 50.00% 37.80% 2.22% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611142895 G -> A LOC_Os06g19570.1 upstream_gene_variant ; 576.0bp to feature; MODIFIER silent_mutation Average:25.407; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0611142895 G -> A LOC_Os06g19550-LOC_Os06g19570 intergenic_region ; MODIFIER silent_mutation Average:25.407; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0611142895 G -> DEL N N silent_mutation Average:25.407; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611142895 NA 1.03E-32 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 1.50E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 2.64E-10 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 6.35E-34 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 1.25E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 2.31E-17 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 4.30E-14 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 4.66E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 3.26E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 1.94E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 5.84E-12 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 3.47E-07 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 1.56E-33 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 5.01E-10 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 7.61E-16 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 2.58E-15 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 6.50E-18 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 9.19E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 1.19E-06 mr1341_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 1.44E-12 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 8.84E-25 mr1531_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 4.17E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 1.33E-35 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 2.77E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 1.57E-10 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 4.41E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 9.89E-34 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611142895 NA 4.30E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251