\
| Variant ID: vg0611136921 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11136921 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATTATATCATTGGGTTTTCTAAATTGAAAATAGAAAGAGAAAAACTTCTTTCTATAAGTGAAAGCCTAAATTTAATCCTTAAAAACTAAAAATGGACCCT[C/T]
TTATTGAACAACCAACCAAATATTTGTTTTTCCACTGACCCGTGTAAAAAAAATATCGCTTCTCCAAGTGCGCGATCTTCTCTCCCCGTGTACAAAGAGA
TCTCTTTGTACACGGGGAGAGAAGATCGCGCACTTGGAGAAGCGATATTTTTTTTACACGGGTCAGTGGAAAAACAAATATTTGGTTGGTTGTTCAATAA[G/A]
AGGGTCCATTTTTAGTTTTTAAGGATTAAATTTAGGCTTTCACTTATAGAAAGAAGTTTTTCTCTTTCTATTTTCAATTTAGAAAACCCAATGATATAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.70% | 8.80% | 0.23% | 23.30% | NA |
| All Indica | 2759 | 61.10% | 0.20% | 0.36% | 38.31% | NA |
| All Japonica | 1512 | 71.50% | 26.70% | 0.07% | 1.79% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 27.40% | 0.30% | 0.34% | 71.93% | NA |
| Indica II | 465 | 92.90% | 0.00% | 0.22% | 6.88% | NA |
| Indica III | 913 | 70.60% | 0.00% | 0.22% | 29.13% | NA |
| Indica Intermediate | 786 | 56.90% | 0.40% | 0.64% | 42.11% | NA |
| Temperate Japonica | 767 | 53.80% | 43.90% | 0.13% | 2.09% | NA |
| Tropical Japonica | 504 | 96.60% | 2.80% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 75.10% | 21.60% | 0.00% | 3.32% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 83.30% | 5.60% | 0.00% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611136921 | C -> T | LOC_Os06g19550.1 | upstream_gene_variant ; 2271.0bp to feature; MODIFIER | silent_mutation | Average:27.338; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0611136921 | C -> T | LOC_Os06g19550.2 | upstream_gene_variant ; 2271.0bp to feature; MODIFIER | silent_mutation | Average:27.338; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0611136921 | C -> T | LOC_Os06g19550-LOC_Os06g19570 | intergenic_region ; MODIFIER | silent_mutation | Average:27.338; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0611136921 | C -> DEL | N | N | silent_mutation | Average:27.338; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611136921 | NA | 2.30E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611136921 | 2.31E-06 | 1.82E-10 | mr1570 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611136921 | NA | 1.61E-06 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611136921 | NA | 5.88E-07 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611136921 | NA | 4.28E-07 | mr1161_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611136921 | NA | 4.17E-11 | mr1570_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611136921 | NA | 7.68E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611136921 | NA | 5.08E-06 | mr1928_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |