\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611136921:

Variant ID: vg0611136921 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11136921
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTATATCATTGGGTTTTCTAAATTGAAAATAGAAAGAGAAAAACTTCTTTCTATAAGTGAAAGCCTAAATTTAATCCTTAAAAACTAAAAATGGACCCT[C/T]
TTATTGAACAACCAACCAAATATTTGTTTTTCCACTGACCCGTGTAAAAAAAATATCGCTTCTCCAAGTGCGCGATCTTCTCTCCCCGTGTACAAAGAGA

Reverse complement sequence

TCTCTTTGTACACGGGGAGAGAAGATCGCGCACTTGGAGAAGCGATATTTTTTTTACACGGGTCAGTGGAAAAACAAATATTTGGTTGGTTGTTCAATAA[G/A]
AGGGTCCATTTTTAGTTTTTAAGGATTAAATTTAGGCTTTCACTTATAGAAAGAAGTTTTTCTCTTTCTATTTTCAATTTAGAAAACCCAATGATATAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.70% 8.80% 0.23% 23.30% NA
All Indica  2759 61.10% 0.20% 0.36% 38.31% NA
All Japonica  1512 71.50% 26.70% 0.07% 1.79% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 27.40% 0.30% 0.34% 71.93% NA
Indica II  465 92.90% 0.00% 0.22% 6.88% NA
Indica III  913 70.60% 0.00% 0.22% 29.13% NA
Indica Intermediate  786 56.90% 0.40% 0.64% 42.11% NA
Temperate Japonica  767 53.80% 43.90% 0.13% 2.09% NA
Tropical Japonica  504 96.60% 2.80% 0.00% 0.60% NA
Japonica Intermediate  241 75.10% 21.60% 0.00% 3.32% NA
VI/Aromatic  96 92.70% 0.00% 0.00% 7.29% NA
Intermediate  90 83.30% 5.60% 0.00% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611136921 C -> T LOC_Os06g19550.1 upstream_gene_variant ; 2271.0bp to feature; MODIFIER silent_mutation Average:27.338; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0611136921 C -> T LOC_Os06g19550.2 upstream_gene_variant ; 2271.0bp to feature; MODIFIER silent_mutation Average:27.338; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0611136921 C -> T LOC_Os06g19550-LOC_Os06g19570 intergenic_region ; MODIFIER silent_mutation Average:27.338; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0611136921 C -> DEL N N silent_mutation Average:27.338; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611136921 NA 2.30E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611136921 2.31E-06 1.82E-10 mr1570 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611136921 NA 1.61E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611136921 NA 5.88E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611136921 NA 4.28E-07 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611136921 NA 4.17E-11 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611136921 NA 7.68E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611136921 NA 5.08E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251