\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611125168:

Variant ID: vg0611125168 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11125168
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.18, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CTTACTAGGCTAGGCTGTCCAAAACCAGGAGTTACGAGCTAACCGATATAGAGGTGTCATCATCTGATGAAACTAGACAATTTATCCTCCTCCACTAGGG[G/A]
TGAAAACGGAGCGGATGTTATCCGATCCGATCCGCTCCGAATCCGTCCGATGTGAGGATTTGGCAAGGGTTTTTAGATATCCGGCCGGATGCGGATGCGG

Reverse complement sequence

CCGCATCCGCATCCGGCCGGATATCTAAAAACCCTTGCCAAATCCTCACATCGGACGGATTCGGAGCGGATCGGATCGGATAACATCCGCTCCGTTTTCA[C/T]
CCCTAGTGGAGGAGGATAAATTGTCTAGTTTCATCAGATGATGACACCTCTATATCGGTTAGCTCGTAACTCCTGGTTTTGGACAGCCTAGCCTAGTAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.30% 28.20% 1.52% 2.98% NA
All Indica  2759 50.90% 41.50% 2.54% 5.07% NA
All Japonica  1512 89.40% 10.60% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 80.00% 19.70% 0.17% 0.17% NA
Indica II  465 12.90% 86.50% 0.22% 0.43% NA
Indica III  913 48.20% 32.00% 6.90% 12.92% NA
Indica Intermediate  786 54.60% 42.40% 0.64% 2.42% NA
Temperate Japonica  767 92.00% 8.00% 0.00% 0.00% NA
Tropical Japonica  504 87.30% 12.70% 0.00% 0.00% NA
Japonica Intermediate  241 85.50% 14.50% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 68.90% 27.80% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611125168 G -> A LOC_Os06g19540.1 upstream_gene_variant ; 1495.0bp to feature; MODIFIER silent_mutation Average:66.025; most accessible tissue: Zhenshan97 young leaf, score: 86.698 N N N N
vg0611125168 G -> A LOC_Os06g19540-LOC_Os06g19550 intergenic_region ; MODIFIER silent_mutation Average:66.025; most accessible tissue: Zhenshan97 young leaf, score: 86.698 N N N N
vg0611125168 G -> DEL N N silent_mutation Average:66.025; most accessible tissue: Zhenshan97 young leaf, score: 86.698 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611125168 NA 3.25E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611125168 NA 2.04E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611125168 NA 1.03E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611125168 4.50E-07 4.50E-07 mr1850 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611125168 2.39E-06 NA mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611125168 6.23E-06 NA mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611125168 4.00E-06 NA mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611125168 1.95E-06 NA mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611125168 8.37E-07 4.94E-10 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611125168 NA 4.89E-08 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611125168 NA 3.00E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611125168 NA 3.24E-08 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611125168 4.01E-06 NA mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611125168 NA 6.34E-08 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611125168 NA 4.02E-07 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251