\
| Variant ID: vg0611125168 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11125168 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.18, others allele: 0.00, population size: 90. )
CTTACTAGGCTAGGCTGTCCAAAACCAGGAGTTACGAGCTAACCGATATAGAGGTGTCATCATCTGATGAAACTAGACAATTTATCCTCCTCCACTAGGG[G/A]
TGAAAACGGAGCGGATGTTATCCGATCCGATCCGCTCCGAATCCGTCCGATGTGAGGATTTGGCAAGGGTTTTTAGATATCCGGCCGGATGCGGATGCGG
CCGCATCCGCATCCGGCCGGATATCTAAAAACCCTTGCCAAATCCTCACATCGGACGGATTCGGAGCGGATCGGATCGGATAACATCCGCTCCGTTTTCA[C/T]
CCCTAGTGGAGGAGGATAAATTGTCTAGTTTCATCAGATGATGACACCTCTATATCGGTTAGCTCGTAACTCCTGGTTTTGGACAGCCTAGCCTAGTAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.30% | 28.20% | 1.52% | 2.98% | NA |
| All Indica | 2759 | 50.90% | 41.50% | 2.54% | 5.07% | NA |
| All Japonica | 1512 | 89.40% | 10.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 80.00% | 19.70% | 0.17% | 0.17% | NA |
| Indica II | 465 | 12.90% | 86.50% | 0.22% | 0.43% | NA |
| Indica III | 913 | 48.20% | 32.00% | 6.90% | 12.92% | NA |
| Indica Intermediate | 786 | 54.60% | 42.40% | 0.64% | 2.42% | NA |
| Temperate Japonica | 767 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 87.30% | 12.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.50% | 14.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 27.80% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611125168 | G -> A | LOC_Os06g19540.1 | upstream_gene_variant ; 1495.0bp to feature; MODIFIER | silent_mutation | Average:66.025; most accessible tissue: Zhenshan97 young leaf, score: 86.698 | N | N | N | N |
| vg0611125168 | G -> A | LOC_Os06g19540-LOC_Os06g19550 | intergenic_region ; MODIFIER | silent_mutation | Average:66.025; most accessible tissue: Zhenshan97 young leaf, score: 86.698 | N | N | N | N |
| vg0611125168 | G -> DEL | N | N | silent_mutation | Average:66.025; most accessible tissue: Zhenshan97 young leaf, score: 86.698 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611125168 | NA | 3.25E-07 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611125168 | NA | 2.04E-06 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611125168 | NA | 1.03E-06 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611125168 | 4.50E-07 | 4.50E-07 | mr1850 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611125168 | 2.39E-06 | NA | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611125168 | 6.23E-06 | NA | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611125168 | 4.00E-06 | NA | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611125168 | 1.95E-06 | NA | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611125168 | 8.37E-07 | 4.94E-10 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611125168 | NA | 4.89E-08 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611125168 | NA | 3.00E-07 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611125168 | NA | 3.24E-08 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611125168 | 4.01E-06 | NA | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611125168 | NA | 6.34E-08 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611125168 | NA | 4.02E-07 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |