\
| Variant ID: vg0611098317 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11098317 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 200. )
TCTGTCTGAGTGCCCATCGTGGCAAGATCCAAAATCCCTGCTTTATTTCTTCGCTGAGAATCTTATTTGTTTGCTGTGGCTTATTTGGAGACGGCTGCTG[C/T]
TCGCTTTTTTTTTTGTCCACACACACCAGGGGCAAGACGGCCAATTCGCCATCGAGATTCCACGTCCGCTGCTGATGTGGCATCAAAATGGGAAGAAAAT
ATTTTCTTCCCATTTTGATGCCACATCAGCAGCGGACGTGGAATCTCGATGGCGAATTGGCCGTCTTGCCCCTGGTGTGTGTGGACAAAAAAAAAAGCGA[G/A]
CAGCAGCCGTCTCCAAATAAGCCACAGCAAACAAATAAGATTCTCAGCGAAGAAATAAAGCAGGGATTTTGGATCTTGCCACGATGGGCACTCAGACAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.40% | 11.70% | 3.94% | 1.93% | NA |
| All Indica | 2759 | 75.60% | 15.30% | 6.23% | 2.90% | NA |
| All Japonica | 1512 | 95.00% | 4.00% | 0.53% | 0.46% | NA |
| Aus | 269 | 78.10% | 21.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 86.90% | 8.90% | 4.03% | 0.17% | NA |
| Indica II | 465 | 77.40% | 3.70% | 14.84% | 4.09% | NA |
| Indica III | 913 | 68.70% | 24.60% | 2.96% | 3.72% | NA |
| Indica Intermediate | 786 | 73.90% | 16.20% | 6.62% | 3.31% | NA |
| Temperate Japonica | 767 | 99.60% | 0.10% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 85.90% | 11.50% | 1.19% | 1.39% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 7.80% | 5.56% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611098317 | C -> T | LOC_Os06g19480.1 | upstream_gene_variant ; 1049.0bp to feature; MODIFIER | silent_mutation | Average:50.97; most accessible tissue: Callus, score: 73.906 | N | N | N | N |
| vg0611098317 | C -> T | LOC_Os06g19470.1 | downstream_gene_variant ; 4043.0bp to feature; MODIFIER | silent_mutation | Average:50.97; most accessible tissue: Callus, score: 73.906 | N | N | N | N |
| vg0611098317 | C -> T | LOC_Os06g19490.1 | downstream_gene_variant ; 2479.0bp to feature; MODIFIER | silent_mutation | Average:50.97; most accessible tissue: Callus, score: 73.906 | N | N | N | N |
| vg0611098317 | C -> T | LOC_Os06g19500.1 | downstream_gene_variant ; 4691.0bp to feature; MODIFIER | silent_mutation | Average:50.97; most accessible tissue: Callus, score: 73.906 | N | N | N | N |
| vg0611098317 | C -> T | LOC_Os06g19470.3 | downstream_gene_variant ; 4043.0bp to feature; MODIFIER | silent_mutation | Average:50.97; most accessible tissue: Callus, score: 73.906 | N | N | N | N |
| vg0611098317 | C -> T | LOC_Os06g19470.2 | downstream_gene_variant ; 4043.0bp to feature; MODIFIER | silent_mutation | Average:50.97; most accessible tissue: Callus, score: 73.906 | N | N | N | N |
| vg0611098317 | C -> T | LOC_Os06g19480-LOC_Os06g19490 | intergenic_region ; MODIFIER | silent_mutation | Average:50.97; most accessible tissue: Callus, score: 73.906 | N | N | N | N |
| vg0611098317 | C -> DEL | N | N | silent_mutation | Average:50.97; most accessible tissue: Callus, score: 73.906 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611098317 | 4.61E-09 | 2.02E-11 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 1.98E-12 | 8.87E-16 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 5.93E-07 | 1.35E-09 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 7.30E-15 | 1.41E-18 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 6.45E-14 | 3.03E-14 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 1.48E-06 | NA | mr1091 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 8.19E-10 | 1.42E-12 | mr1091 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 4.72E-08 | 6.24E-09 | mr1094 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 6.49E-07 | NA | mr1096 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 4.27E-11 | 2.76E-13 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 2.17E-06 | NA | mr1108 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 2.82E-08 | 4.89E-09 | mr1108 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 1.11E-07 | 8.92E-08 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 3.55E-06 | NA | mr1112 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 7.31E-08 | 5.30E-10 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 1.39E-06 | NA | mr1121 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 1.77E-10 | 2.23E-11 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 5.93E-10 | 3.59E-11 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 4.50E-07 | 2.33E-08 | mr1200 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 1.16E-09 | 6.76E-10 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | NA | 1.23E-07 | mr1218 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 2.71E-06 | NA | mr1237 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 1.18E-06 | 1.10E-08 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 2.78E-07 | 1.91E-09 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 5.14E-06 | NA | mr1065_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 5.51E-11 | 7.61E-14 | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 8.46E-06 | NA | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 2.47E-15 | 8.87E-19 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 1.74E-10 | 6.11E-14 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 2.02E-14 | 4.47E-21 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 4.61E-17 | 7.41E-20 | mr1090_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 1.07E-07 | NA | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 1.12E-09 | 3.01E-13 | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 1.29E-08 | 9.34E-10 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 1.18E-06 | NA | mr1096_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 4.21E-11 | 1.24E-14 | mr1096_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 4.07E-07 | NA | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 4.47E-09 | 1.77E-10 | mr1108_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 1.36E-07 | NA | mr1110_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 4.00E-08 | 8.14E-11 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 3.02E-09 | 7.69E-12 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 3.73E-07 | NA | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 1.05E-08 | 1.38E-11 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 1.14E-09 | 2.96E-12 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 3.49E-09 | 2.28E-11 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 1.31E-09 | 2.96E-10 | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 6.50E-14 | 2.97E-14 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 5.45E-08 | 6.47E-09 | mr1218_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 1.54E-06 | NA | mr1234_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 1.80E-07 | NA | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | NA | 4.94E-07 | mr1244_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611098317 | 3.10E-10 | 2.07E-12 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |