Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0611018738:

Variant ID: vg0611018738 (JBrowse)	Variation Type: INDEL
Chromosome: chr06	Position: 11018738
Reference Allele: G	Alternative Allele: GAGCCA,A
Primary Allele: G	Secondary Allele: GAGCCA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTCTATGAATATGATAAACCATAAATTAATTATTTTTAAAAGATTATCTTTTAAAATATACATTGTTCTAATTAAAAATGAAGCTCGGTAGTCGAGCTC[G/GAGCCA,A]
AGCTGAATATTTTATAGGCTCAGCTCGAGCTTGTATCGAGCTTGGCTTGTTGACAGTCCTACCGATAATTGAAAATGATTAAAATGATTATCACATGTGG

Reverse complement sequence

CCACATGTGATAATCATTTTAATCATTTTCAATTATCGGTAGGACTGTCAACAAGCCAAGCTCGATACAAGCTCGAGCTGAGCCTATAAAATATTCAGCT[C/TGGCTC,T]
GAGCTCGACTACCGAGCTTCATTTTTAATTAGAACAATGTATATTTTAAAAGATAATCTTTTAAAAATAATTAATTTATGGTTTATCATATTCATAGAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of GAGCCA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.60%	0.10%	5.52%	20.65%	A: 0.08%
All Indica	2759	58.40%	0.20%	8.81%	32.48%	A: 0.14%
All Japonica	1512	94.50%	0.10%	1.06%	4.30%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	32.10%	0.00%	10.25%	57.31%	A: 0.34%
Indica II	465	90.30%	0.00%	1.94%	7.74%	NA
Indica III	913	56.00%	0.40%	11.28%	32.20%	A: 0.11%
Indica Intermediate	786	62.20%	0.10%	8.91%	28.63%	A: 0.13%
Temperate Japonica	767	97.90%	0.00%	0.26%	1.83%	NA
Tropical Japonica	504	88.70%	0.00%	2.78%	8.53%	NA
Japonica Intermediate	241	95.90%	0.80%	0.00%	3.32%	NA
VI/Aromatic	96	96.90%	0.00%	1.04%	2.08%	NA
Intermediate	90	84.40%	0.00%	1.11%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0611018738	G -> A	LOC_Os06g19360.1	upstream_gene_variant ; 1257.0bp to feature; MODIFIER	silent_mutation	Average:57.789; most accessible tissue: Minghui63 root, score: 82.349	N	N	N	N
vg0611018738	G -> A	LOC_Os06g19370.1	upstream_gene_variant ; 3573.0bp to feature; MODIFIER	silent_mutation	Average:57.789; most accessible tissue: Minghui63 root, score: 82.349	N	N	N	N
vg0611018738	G -> A	LOC_Os06g19370.2	upstream_gene_variant ; 3573.0bp to feature; MODIFIER	silent_mutation	Average:57.789; most accessible tissue: Minghui63 root, score: 82.349	N	N	N	N
vg0611018738	G -> A	LOC_Os06g19360-LOC_Os06g19370	intergenic_region ; MODIFIER	silent_mutation	Average:57.789; most accessible tissue: Minghui63 root, score: 82.349	N	N	N	N
vg0611018738	G -> DEL	N	N	silent_mutation	Average:57.789; most accessible tissue: Minghui63 root, score: 82.349	N	N	N	N
vg0611018738	G -> GAGCCA	LOC_Os06g19360.1	upstream_gene_variant ; 1258.0bp to feature; MODIFIER	silent_mutation	Average:57.789; most accessible tissue: Minghui63 root, score: 82.349	N	N	N	N
vg0611018738	G -> GAGCCA	LOC_Os06g19370.1	upstream_gene_variant ; 3572.0bp to feature; MODIFIER	silent_mutation	Average:57.789; most accessible tissue: Minghui63 root, score: 82.349	N	N	N	N
vg0611018738	G -> GAGCCA	LOC_Os06g19370.2	upstream_gene_variant ; 3572.0bp to feature; MODIFIER	silent_mutation	Average:57.789; most accessible tissue: Minghui63 root, score: 82.349	N	N	N	N
vg0611018738	G -> GAGCCA	LOC_Os06g19360-LOC_Os06g19370	intergenic_region ; MODIFIER	silent_mutation	Average:57.789; most accessible tissue: Minghui63 root, score: 82.349	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0611018738	4.64E-07	3.82E-07	mr1697	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611018738	2.76E-06	1.28E-06	mr1697	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251