\
| Variant ID: vg0611018738 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr06 | Position: 11018738 |
| Reference Allele: G | Alternative Allele: GAGCCA,A |
| Primary Allele: G | Secondary Allele: GAGCCA |
Inferred Ancestral Allele: Not determined.
CTTCTATGAATATGATAAACCATAAATTAATTATTTTTAAAAGATTATCTTTTAAAATATACATTGTTCTAATTAAAAATGAAGCTCGGTAGTCGAGCTC[G/GAGCCA,A]
AGCTGAATATTTTATAGGCTCAGCTCGAGCTTGTATCGAGCTTGGCTTGTTGACAGTCCTACCGATAATTGAAAATGATTAAAATGATTATCACATGTGG
CCACATGTGATAATCATTTTAATCATTTTCAATTATCGGTAGGACTGTCAACAAGCCAAGCTCGATACAAGCTCGAGCTGAGCCTATAAAATATTCAGCT[C/TGGCTC,T]
GAGCTCGACTACCGAGCTTCATTTTTAATTAGAACAATGTATATTTTAAAAGATAATCTTTTAAAAATAATTAATTTATGGTTTATCATATTCATAGAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of GAGCCA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.60% | 0.10% | 5.52% | 20.65% | A: 0.08% |
| All Indica | 2759 | 58.40% | 0.20% | 8.81% | 32.48% | A: 0.14% |
| All Japonica | 1512 | 94.50% | 0.10% | 1.06% | 4.30% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 32.10% | 0.00% | 10.25% | 57.31% | A: 0.34% |
| Indica II | 465 | 90.30% | 0.00% | 1.94% | 7.74% | NA |
| Indica III | 913 | 56.00% | 0.40% | 11.28% | 32.20% | A: 0.11% |
| Indica Intermediate | 786 | 62.20% | 0.10% | 8.91% | 28.63% | A: 0.13% |
| Temperate Japonica | 767 | 97.90% | 0.00% | 0.26% | 1.83% | NA |
| Tropical Japonica | 504 | 88.70% | 0.00% | 2.78% | 8.53% | NA |
| Japonica Intermediate | 241 | 95.90% | 0.80% | 0.00% | 3.32% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 84.40% | 0.00% | 1.11% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611018738 | G -> A | LOC_Os06g19360.1 | upstream_gene_variant ; 1257.0bp to feature; MODIFIER | silent_mutation | Average:57.789; most accessible tissue: Minghui63 root, score: 82.349 | N | N | N | N |
| vg0611018738 | G -> A | LOC_Os06g19370.1 | upstream_gene_variant ; 3573.0bp to feature; MODIFIER | silent_mutation | Average:57.789; most accessible tissue: Minghui63 root, score: 82.349 | N | N | N | N |
| vg0611018738 | G -> A | LOC_Os06g19370.2 | upstream_gene_variant ; 3573.0bp to feature; MODIFIER | silent_mutation | Average:57.789; most accessible tissue: Minghui63 root, score: 82.349 | N | N | N | N |
| vg0611018738 | G -> A | LOC_Os06g19360-LOC_Os06g19370 | intergenic_region ; MODIFIER | silent_mutation | Average:57.789; most accessible tissue: Minghui63 root, score: 82.349 | N | N | N | N |
| vg0611018738 | G -> DEL | N | N | silent_mutation | Average:57.789; most accessible tissue: Minghui63 root, score: 82.349 | N | N | N | N |
| vg0611018738 | G -> GAGCCA | LOC_Os06g19360.1 | upstream_gene_variant ; 1258.0bp to feature; MODIFIER | silent_mutation | Average:57.789; most accessible tissue: Minghui63 root, score: 82.349 | N | N | N | N |
| vg0611018738 | G -> GAGCCA | LOC_Os06g19370.1 | upstream_gene_variant ; 3572.0bp to feature; MODIFIER | silent_mutation | Average:57.789; most accessible tissue: Minghui63 root, score: 82.349 | N | N | N | N |
| vg0611018738 | G -> GAGCCA | LOC_Os06g19370.2 | upstream_gene_variant ; 3572.0bp to feature; MODIFIER | silent_mutation | Average:57.789; most accessible tissue: Minghui63 root, score: 82.349 | N | N | N | N |
| vg0611018738 | G -> GAGCCA | LOC_Os06g19360-LOC_Os06g19370 | intergenic_region ; MODIFIER | silent_mutation | Average:57.789; most accessible tissue: Minghui63 root, score: 82.349 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611018738 | 4.64E-07 | 3.82E-07 | mr1697 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611018738 | 2.76E-06 | 1.28E-06 | mr1697 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |