Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611006878:

Variant ID: vg0611006878 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 11006878
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

AGGGAGGCGATCTTGGATTTCCACGTCTTTGAAATCCAATACTTTGATATCCTAGTCGGGCTGCCCATTGAGCAACTTCTCATCAACACACCCCGATTAG[G/T,A]
TAACCTCAAAATAACACGGGGAGAGAATGAATTCTCAATTCCATTCTCGCAGGCAAGGATCACCTTGACCGACACTCTCCTAGAAATTGAGTCAGCAGAA

Reverse complement sequence

TTCTGCTGACTCAATTTCTAGGAGAGTGTCGGTCAAGGTGATCCTTGCCTGCGAGAATGGAATTGAGAATTCATTCTCTCCCCGTGTTATTTTGAGGTTA[C/A,T]
CTAATCGGGGTGTGTTGATGAGAAGTTGCTCAATGGGCAGCCCGACTAGGATATCAAAGTATTGGATTTCAAAGACGTGGAAATCCAAGATCGCCTCCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.50%	27.40%	0.08%	0.06%	NA
All Indica	2759	57.20%	42.70%	0.04%	0.11%	NA
All Japonica	1512	94.60%	5.40%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	77.10%	22.90%	0.00%	0.00%	NA
Indica II	465	12.90%	87.10%	0.00%	0.00%	NA
Indica III	913	68.80%	31.00%	0.11%	0.11%	NA
Indica Intermediate	786	54.70%	45.00%	0.00%	0.25%	NA
Temperate Japonica	767	98.40%	1.60%	0.00%	0.00%	NA
Tropical Japonica	504	87.30%	12.70%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	60.00%	36.70%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0611006878	G -> T	LOC_Os06g19350.1	missense_variant ; p.Gly356Val; MODERATE	nonsynonymous_codon ; G356V	Average:41.429; most accessible tissue: Minghui63 flag leaf, score: 55.781	probably damaging	2.241	DELETERIOUS	0.00
vg0611006878	G -> A	LOC_Os06g19350.1	missense_variant ; p.Gly356Asp; MODERATE	N	Average:41.429; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N
vg0611006878	G -> A	LOC_Os06g19340.1	upstream_gene_variant ; 2623.0bp to feature; MODIFIER	N	Average:41.429; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N
vg0611006878	G -> DEL	LOC_Os06g19350.1	N	frameshift_variant	Average:41.429; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0611006878	4.49E-06	NA	mr1068	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	2.28E-06	2.91E-09	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	2.85E-06	NA	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	3.83E-06	1.17E-11	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	NA	2.24E-07	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	NA	2.66E-08	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	NA	5.32E-06	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	6.00E-07	NA	mr1065_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	3.98E-07	NA	mr1065_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	5.55E-09	NA	mr1068_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	8.25E-08	2.31E-10	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	7.81E-06	NA	mr1078_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	6.19E-07	NA	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	3.95E-06	NA	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	2.55E-06	NA	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	7.47E-10	NA	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	8.07E-11	9.61E-17	mr1090_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	1.86E-07	NA	mr1091_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	3.62E-07	NA	mr1094_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	4.49E-06	1.34E-08	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	3.66E-08	NA	mr1096_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	2.93E-07	8.17E-09	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	1.83E-06	NA	mr1108_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	9.09E-06	NA	mr1108_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	1.34E-08	NA	mr1111_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	1.62E-08	1.46E-07	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	2.10E-06	NA	mr1112_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	1.47E-07	NA	mr1121_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	4.68E-07	5.36E-10	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	NA	9.29E-07	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	2.23E-09	NA	mr1144_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	1.62E-08	4.70E-08	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	2.48E-07	NA	mr1200_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	2.31E-07	NA	mr1200_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	8.24E-08	NA	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	6.60E-09	1.47E-13	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	5.39E-07	NA	mr1234_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	5.29E-06	NA	mr1234_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	8.81E-06	NA	mr1244_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	7.14E-06	1.87E-08	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	NA	5.46E-06	mr1671_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	NA	6.69E-06	mr1679_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	NA	8.36E-06	mr1691_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	NA	8.27E-06	mr1887_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	NA	6.15E-06	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611006878	NA	4.50E-07	mr1974_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251