\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610957761:

Variant ID: vg0610957761 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10957761
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 163. )

Flanking Sequence (100 bp) in Reference Genome:


ACTATGGCAGTTCGACAGGTACATGTCGAACTGCCATAGTTCGATAAGTACCTCTATCGAGACACGGTTGTTCGACAGGGTGCTAAATTTACGATTTCGT[C/T]
GAACCGACCTATATTTTTGCGATTTTCTATTAAAATCGTATTATTTTTTAAAAAAATTCCAAAAATAGCAACATTATTTCCTCGAAAAGGAGATAAGAAA

Reverse complement sequence

TTTCTTATCTCCTTTTCGAGGAAATAATGTTGCTATTTTTGGAATTTTTTTAAAAAATAATACGATTTTAATAGAAAATCGCAAAAATATAGGTCGGTTC[G/A]
ACGAAATCGTAAATTTAGCACCCTGTCGAACAACCGTGTCTCGATAGAGGTACTTATCGAACTATGGCAGTTCGACATGTACCTGTCGAACTGCCATAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.00% 11.30% 0.55% 12.21% NA
All Indica  2759 65.30% 15.70% 0.87% 18.19% NA
All Japonica  1512 93.60% 5.80% 0.13% 0.53% NA
Aus  269 77.70% 1.10% 0.00% 21.19% NA
Indica I  595 89.70% 1.80% 0.00% 8.40% NA
Indica II  465 76.80% 9.20% 0.43% 13.55% NA
Indica III  913 38.10% 34.10% 1.64% 26.18% NA
Indica Intermediate  786 71.50% 8.50% 0.89% 19.08% NA
Temperate Japonica  767 97.30% 2.10% 0.00% 0.65% NA
Tropical Japonica  504 87.50% 12.30% 0.20% 0.00% NA
Japonica Intermediate  241 94.60% 3.70% 0.41% 1.24% NA
VI/Aromatic  96 92.70% 4.20% 0.00% 3.12% NA
Intermediate  90 85.60% 6.70% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610957761 C -> T LOC_Os06g19260.1 3_prime_UTR_variant ; 173.0bp to feature; MODIFIER silent_mutation Average:59.85; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0610957761 C -> T LOC_Os06g19250.1 downstream_gene_variant ; 224.0bp to feature; MODIFIER silent_mutation Average:59.85; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0610957761 C -> DEL N N silent_mutation Average:59.85; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610957761 1.57E-06 NA mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 8.76E-06 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 8.54E-07 NA mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 3.90E-06 NA mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 3.92E-09 1.22E-11 mr1087 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 1.72E-06 NA mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 5.99E-06 NA mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 1.26E-07 NA mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 6.23E-07 NA mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 1.11E-08 3.84E-08 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 6.57E-06 NA mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 NA 8.49E-07 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 4.59E-06 3.98E-07 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 1.98E-06 NA mr1065_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 3.80E-07 NA mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 6.04E-08 NA mr1068_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 1.42E-07 1.14E-08 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 5.13E-06 1.19E-07 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 7.16E-06 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 1.42E-07 1.95E-11 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 1.47E-06 4.73E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 3.73E-08 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 8.23E-10 NA mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 3.51E-06 8.55E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 3.44E-06 NA mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 6.17E-06 NA mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 4.45E-07 NA mr1112_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 8.52E-07 NA mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 4.07E-06 NA mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 2.06E-06 NA mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 5.37E-06 NA mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 1.30E-07 4.14E-09 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 1.80E-06 NA mr1695_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610957761 4.95E-06 8.57E-08 mr1695_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251