Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610936973:

Variant ID: vg0610936973 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10936973
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, G: 0.11, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


ACGGCGGGGCGGCGGCAAGCGGGAGGGGAGCGAGAGACGGAGAGAGCTCGGTTTGCGGGCGGCGCACCTTTGCCACCGGCCGGCGGCGGCGGCGGCCGTC[A/G]
GTGGGTGGGTGGTCGCACCGCCTCCCGTTGCAGATCGGGCTCACATGTCAGCCCAAAAGTGAGCGTAAATTCGGCCCAAAAGTACGGGTCAATTTGGTGA

Reverse complement sequence

TCACCAAATTGACCCGTACTTTTGGGCCGAATTTACGCTCACTTTTGGGCTGACATGTGAGCCCGATCTGCAACGGGAGGCGGTGCGACCACCCACCCAC[T/C]
GACGGCCGCCGCCGCCGCCGGCCGGTGGCAAAGGTGCGCCGCCCGCAAACCGAGCTCTCTCCGTCTCTCGCTCCCCTCCCGCTTGCCGCCGCCCCGCCGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.10% 24.40% 0.49% 0.00% NA
All Indica  2759 63.90% 35.30% 0.80% 0.00% NA
All Japonica  1512 93.50% 6.50% 0.00% 0.00% NA
Aus  269 77.00% 23.00% 0.00% 0.00% NA
Indica I  595 89.60% 10.40% 0.00% 0.00% NA
Indica II  465 75.30% 24.70% 0.00% 0.00% NA
Indica III  913 38.20% 61.30% 0.44% 0.00% NA
Indica Intermediate  786 67.70% 30.00% 2.29% 0.00% NA
Temperate Japonica  767 97.10% 2.90% 0.00% 0.00% NA
Tropical Japonica  504 87.30% 12.70% 0.00% 0.00% NA
Japonica Intermediate  241 94.60% 5.40% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 84.40% 14.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610936973 A -> G LOC_Os06g19220.1 upstream_gene_variant ; 230.0bp to feature; MODIFIER silent_mutation Average:97.777; most accessible tissue: Zhenshan97 panicle, score: 99.06 N N N N
vg0610936973 A -> G LOC_Os06g19210.1 downstream_gene_variant ; 1757.0bp to feature; MODIFIER silent_mutation Average:97.777; most accessible tissue: Zhenshan97 panicle, score: 99.06 N N N N
vg0610936973 A -> G LOC_Os06g19230.1 downstream_gene_variant ; 923.0bp to feature; MODIFIER silent_mutation Average:97.777; most accessible tissue: Zhenshan97 panicle, score: 99.06 N N N N
vg0610936973 A -> G LOC_Os06g19220-LOC_Os06g19230 intergenic_region ; MODIFIER silent_mutation Average:97.777; most accessible tissue: Zhenshan97 panicle, score: 99.06 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0610936973 A G 0.0 0.01 0.06 0.01 0.03 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610936973 1.51E-08 9.00E-11 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 NA 3.98E-10 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 9.97E-12 1.53E-13 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 2.09E-06 NA mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 3.19E-09 2.96E-11 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 4.24E-06 NA mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 6.17E-07 NA mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 7.42E-07 NA mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 1.77E-06 1.77E-06 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 4.22E-07 NA mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 1.19E-08 1.68E-10 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 2.85E-06 4.30E-09 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 NA 2.44E-08 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 1.61E-06 2.58E-08 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 5.05E-08 5.05E-08 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 NA 4.42E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 2.29E-06 1.40E-07 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 8.83E-07 5.37E-11 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 5.07E-07 NA mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 NA 1.04E-07 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 4.15E-08 NA mr1065_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 1.50E-10 4.29E-13 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 9.51E-06 NA mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 2.10E-07 6.70E-12 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 4.63E-06 NA mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 1.58E-06 3.09E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 1.82E-06 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 1.13E-11 1.37E-16 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 9.62E-09 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 9.34E-10 8.56E-12 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 2.48E-06 NA mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 5.50E-08 2.26E-11 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 8.71E-07 NA mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 1.94E-07 2.84E-08 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 3.08E-07 NA mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 5.25E-09 2.46E-10 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 1.78E-12 1.02E-15 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 6.78E-06 NA mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 6.97E-08 7.20E-09 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 2.29E-07 NA mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 1.78E-07 4.48E-11 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 5.27E-08 5.27E-08 mr1477_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 2.86E-06 NA mr1526_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 2.32E-10 1.23E-13 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 NA 9.51E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 2.04E-06 NA mr1695_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 9.08E-06 1.55E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610936973 8.26E-09 8.26E-09 mr1971_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251