\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610917532:

Variant ID: vg0610917532 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10917532
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.07, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


GCAAAATTTCCTGCATCCAGGACTCAGCTATCATGATTCATGATCTTGCATACATCTAGACAGGCCATAGATCAGTCCTAAAGTTGTGATTGTATACAAT[A/G]
TAATGGGTACAAAAAGAGCTGCCAAATATAATTCTTGCTGATTTTGCAAAGAAATGAAGAGGAGAGAAGTGCATCTCATTATATCCTAAAGAGTAAAAAC

Reverse complement sequence

GTTTTTACTCTTTAGGATATAATGAGATGCACTTCTCTCCTCTTCATTTCTTTGCAAAATCAGCAAGAATTATATTTGGCAGCTCTTTTTGTACCCATTA[T/C]
ATTGTATACAATCACAACTTTAGGACTGATCTATGGCCTGTCTAGATGTATGCAAGATCATGAATCATGATAGCTGAGTCCTGGATGCAGGAAATTTTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.20% 13.80% 0.36% 5.67% NA
All Indica  2759 79.40% 20.40% 0.04% 0.11% NA
All Japonica  1512 77.80% 4.80% 1.06% 16.27% NA
Aus  269 98.50% 0.00% 0.00% 1.49% NA
Indica I  595 90.90% 8.70% 0.00% 0.34% NA
Indica II  465 84.10% 15.90% 0.00% 0.00% NA
Indica III  913 69.80% 30.00% 0.11% 0.11% NA
Indica Intermediate  786 79.30% 20.70% 0.00% 0.00% NA
Temperate Japonica  767 68.20% 0.90% 1.17% 29.73% NA
Tropical Japonica  504 86.10% 11.70% 0.40% 1.79% NA
Japonica Intermediate  241 91.30% 2.90% 2.07% 3.73% NA
VI/Aromatic  96 90.60% 1.00% 0.00% 8.33% NA
Intermediate  90 77.80% 14.40% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610917532 A -> G LOC_Os06g19170.1 downstream_gene_variant ; 2042.0bp to feature; MODIFIER silent_mutation Average:63.841; most accessible tissue: Callus, score: 82.574 N N N N
vg0610917532 A -> G LOC_Os06g19170-LOC_Os06g19200 intergenic_region ; MODIFIER silent_mutation Average:63.841; most accessible tissue: Callus, score: 82.574 N N N N
vg0610917532 A -> DEL N N silent_mutation Average:63.841; most accessible tissue: Callus, score: 82.574 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610917532 7.62E-06 NA mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610917532 8.10E-06 NA mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610917532 NA 1.85E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610917532 2.14E-06 3.24E-07 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610917532 4.98E-06 4.76E-09 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610917532 NA 2.38E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610917532 NA 1.48E-06 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610917532 NA 2.31E-09 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610917532 1.47E-07 NA mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610917532 6.74E-06 NA mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610917532 2.79E-08 NA mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610917532 2.07E-06 NA mr1124_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610917532 NA 5.41E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610917532 NA 1.06E-06 mr1946_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610917532 NA 1.06E-06 mr1948_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251