\
| Variant ID: vg0610917532 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10917532 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.07, others allele: 0.00, population size: 227. )
GCAAAATTTCCTGCATCCAGGACTCAGCTATCATGATTCATGATCTTGCATACATCTAGACAGGCCATAGATCAGTCCTAAAGTTGTGATTGTATACAAT[A/G]
TAATGGGTACAAAAAGAGCTGCCAAATATAATTCTTGCTGATTTTGCAAAGAAATGAAGAGGAGAGAAGTGCATCTCATTATATCCTAAAGAGTAAAAAC
GTTTTTACTCTTTAGGATATAATGAGATGCACTTCTCTCCTCTTCATTTCTTTGCAAAATCAGCAAGAATTATATTTGGCAGCTCTTTTTGTACCCATTA[T/C]
ATTGTATACAATCACAACTTTAGGACTGATCTATGGCCTGTCTAGATGTATGCAAGATCATGAATCATGATAGCTGAGTCCTGGATGCAGGAAATTTTGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.20% | 13.80% | 0.36% | 5.67% | NA |
| All Indica | 2759 | 79.40% | 20.40% | 0.04% | 0.11% | NA |
| All Japonica | 1512 | 77.80% | 4.80% | 1.06% | 16.27% | NA |
| Aus | 269 | 98.50% | 0.00% | 0.00% | 1.49% | NA |
| Indica I | 595 | 90.90% | 8.70% | 0.00% | 0.34% | NA |
| Indica II | 465 | 84.10% | 15.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 69.80% | 30.00% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 79.30% | 20.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 68.20% | 0.90% | 1.17% | 29.73% | NA |
| Tropical Japonica | 504 | 86.10% | 11.70% | 0.40% | 1.79% | NA |
| Japonica Intermediate | 241 | 91.30% | 2.90% | 2.07% | 3.73% | NA |
| VI/Aromatic | 96 | 90.60% | 1.00% | 0.00% | 8.33% | NA |
| Intermediate | 90 | 77.80% | 14.40% | 0.00% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610917532 | A -> G | LOC_Os06g19170.1 | downstream_gene_variant ; 2042.0bp to feature; MODIFIER | silent_mutation | Average:63.841; most accessible tissue: Callus, score: 82.574 | N | N | N | N |
| vg0610917532 | A -> G | LOC_Os06g19170-LOC_Os06g19200 | intergenic_region ; MODIFIER | silent_mutation | Average:63.841; most accessible tissue: Callus, score: 82.574 | N | N | N | N |
| vg0610917532 | A -> DEL | N | N | silent_mutation | Average:63.841; most accessible tissue: Callus, score: 82.574 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610917532 | 7.62E-06 | NA | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610917532 | 8.10E-06 | NA | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610917532 | NA | 1.85E-06 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610917532 | 2.14E-06 | 3.24E-07 | mr1218 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610917532 | 4.98E-06 | 4.76E-09 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610917532 | NA | 2.38E-06 | mr1242 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610917532 | NA | 1.48E-06 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610917532 | NA | 2.31E-09 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610917532 | 1.47E-07 | NA | mr1067_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610917532 | 6.74E-06 | NA | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610917532 | 2.79E-08 | NA | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610917532 | 2.07E-06 | NA | mr1124_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610917532 | NA | 5.41E-09 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610917532 | NA | 1.06E-06 | mr1946_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610917532 | NA | 1.06E-06 | mr1948_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |