Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610912711:

Variant ID: vg0610912711 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 10912711
Reference Allele: AAlternative Allele: G,AGG
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


CGGTACCTTGTTTTCTTCTACTGCAATGCGGCTGCATTTGCTTTGTCCATTGTGGTCATCATCCTCATCCTCATCCTTGCCGTCGTACACGAGAAGGAAG[A/G,AGG]
GCTATGGATCTCCATGATCCCACTGCGGGTGGCCATGATGCTGGATCTGCTTGGCCTCGTGGGGGCCTATGCTGCTGGGACCAGCCGGGGTGTGCTAAAA

Reverse complement sequence

TTTTAGCACACCCCGGCTGGTCCCAGCAGCATAGGCCCCCACGAGGCCAAGCAGATCCAGCATCATGGCCACCCGCAGTGGGATCATGGAGATCCATAGC[T/C,CCT]
CTTCCTTCTCGTGTACGACGGCAAGGATGAGGATGAGGATGATGACCACAATGGACAAAGCAAATGCAGCCGCATTGCAGTAGAAGAAAACAAGGTACCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.60% 16.00% 1.31% 3.09% AGG: 0.02%
All Indica  2759 79.50% 14.80% 1.38% 4.35% NA
All Japonica  1512 75.90% 21.20% 1.39% 1.52% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 90.90% 7.10% 0.50% 1.51% NA
Indica II  465 84.30% 11.20% 1.72% 2.80% NA
Indica III  913 69.80% 21.90% 1.97% 6.35% NA
Indica Intermediate  786 79.30% 14.50% 1.15% 5.09% NA
Temperate Japonica  767 65.10% 31.00% 1.43% 2.48% NA
Tropical Japonica  504 85.50% 13.30% 0.99% 0.20% NA
Japonica Intermediate  241 90.50% 6.20% 2.07% 1.24% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 77.80% 14.40% 3.33% 3.33% AGG: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610912711 A -> G LOC_Os06g19170.1 missense_variant ; p.Glu102Gly; MODERATE nonsynonymous_codon ; E102G Average:86.621; most accessible tissue: Minghui63 flag leaf, score: 92.472 possibly damaging -1.81 TOLERATED 0.40
vg0610912711 A -> AGG LOC_Os06g19170.1 frameshift_variant ; p.Leu103fs; HIGH frameshift_variant Average:86.621; most accessible tissue: Minghui63 flag leaf, score: 92.472 N N N N
vg0610912711 A -> DEL LOC_Os06g19170.1 N frameshift_variant Average:86.621; most accessible tissue: Minghui63 flag leaf, score: 92.472 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0610912711 A AGG -0.09 -0.09 -0.06 -0.09 -0.12 -0.12
vg0610912711 A G -0.02 0.02 0.01 0.03 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610912711 8.10E-06 NA mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610912711 NA 1.85E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610912711 1.69E-06 NA mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610912711 2.14E-06 3.24E-07 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610912711 7.48E-06 NA mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610912711 4.98E-06 4.76E-09 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610912711 NA 2.38E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610912711 NA 1.48E-06 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610912711 3.72E-06 NA mr1583 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610912711 NA 2.31E-09 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610912711 NA 1.59E-06 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610912711 8.30E-06 1.14E-07 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610912711 6.74E-06 NA mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610912711 2.79E-08 NA mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610912711 NA 5.41E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610912711 NA 1.06E-06 mr1946_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610912711 NA 1.06E-06 mr1948_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610912711 NA 1.35E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251