Search for Variation information by Variation ID:
Detailed information for vg0610909238:
| Variant ID: vg0610909238 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10909238 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 327. )
Flanking Sequence (100 bp) in Reference Genome:
TGTGAGTGACCTTCTCTTATCCAAATCTGCAGCAAAATCTGAATCCACATATCCAACAAGCCCCTTATCAGTCCTCCCAAACTTCAAGCAAGCATCAGCT[G/A]
TGCCTCTGAGGTACTTGAAAATCCACTGAACAGCTTTCCAGTGTTCTTTACCAGGATTAGCCATGTATCTACTAACCAAACTCATAGCATGAGATAAATC
Reverse complement sequence
GATTTATCTCATGCTATGAGTTTGGTTAGTAGATACATGGCTAATCCTGGTAAAGAACACTGGAAAGCTGTTCAGTGGATTTTCAAGTACCTCAGAGGCA[C/T]
AGCTGATGCTTGCTTGAAGTTTGGGAGGACTGATAAGGGGCTTGTTGGATATGTGGATTCAGATTTTGCTGCAGATTTGGATAAGAGAAGGTCACTCACA
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 80.10% | 19.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.40% | 8.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 84.50% | 15.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 70.90% | 29.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 79.80% | 20.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610909238 | G -> A | LOC_Os06g19160.1 | missense_variant ; p.Thr87Ile; MODERATE | nonsynonymous_codon ; T87I | Average:36.188; most accessible tissue: Zhenshan97 flower, score: 61.872 | benign  |
0.978 |
DELETERIOUS | 0.03 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610909238 | 7.70E-06 | NA | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610909238 | NA | 1.36E-06 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610909238 | NA | 1.11E-06 | mr1218 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610909238 | NA | 2.60E-08 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610909238 | NA | 8.27E-08 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610909238 | NA | 7.72E-09 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610909238 | NA | 4.50E-09 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610909238 | NA | 8.86E-06 | mr1932_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610909238 | 3.67E-06 | 1.54E-07 | mr1946_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610909238 | 3.67E-06 | 1.54E-07 | mr1948_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |