\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610886230:

Variant ID: vg0610886230 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 10886230
Reference Allele: AGAlternative Allele: GG,A,TG
Primary Allele: GGSecondary Allele: AG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATTTCAACCTATAATTAAGGGAGTCAAATTGGACTTTTTCCAGTCTATTTAGTGCCTGTTTGGCACGGCTCTAGCTCTAACTCCATCTCTTCTAGAGTT[AG/GG,A,TG]
AGCCTAGCCAAACAGTTTCAGCTCCATATAAAATTGTAGTGGAGCTGGCTAGAGCGCTATCACAAAATGAACTAGATAGGTGGAGCTAGGTTTAGGCTGT

Reverse complement sequence

ACAGCCTAAACCTAGCTCCACCTATCTAGTTCATTTTGTGATAGCGCTCTAGCCAGCTCCACTACAATTTTATATGGAGCTGAAACTGTTTGGCTAGGCT[CT/CC,T,CA]
AACTCTAGAAGAGATGGAGTTAGAGCTAGAGCCGTGCCAAACAGGCACTAAATAGACTGGAAAAAGTCCAATTTGACTCCCTTAATTATAGGTTGAAATC

Allele Frequencies:

Populations Population SizeFrequency of GG(primary allele) Frequency of AG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.00% 33.70% 0.15% 0.00% A: 0.06%; TG: 0.02%
All Indica  2759 65.20% 34.50% 0.22% 0.00% TG: 0.04%
All Japonica  1512 60.40% 39.60% 0.07% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 87.90% 11.80% 0.34% 0.00% NA
Indica II  465 75.50% 24.30% 0.22% 0.00% NA
Indica III  913 40.00% 59.80% 0.11% 0.00% TG: 0.11%
Indica Intermediate  786 71.40% 28.40% 0.25% 0.00% NA
Temperate Japonica  767 36.90% 63.00% 0.13% 0.00% NA
Tropical Japonica  504 89.30% 10.70% 0.00% 0.00% NA
Japonica Intermediate  241 74.70% 25.30% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 70.00% 26.70% 0.00% 0.00% A: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610886230 AG -> A LOC_Os06g19130.1 intron_variant ; MODIFIER silent_mutation Average:68.885; most accessible tissue: Zhenshan97 panicle, score: 89.623 N N N N
vg0610886230 AG -> TG LOC_Os06g19130.1 intron_variant ; MODIFIER silent_mutation Average:68.885; most accessible tissue: Zhenshan97 panicle, score: 89.623 N N N N
vg0610886230 AG -> GG LOC_Os06g19130.1 intron_variant ; MODIFIER silent_mutation Average:68.885; most accessible tissue: Zhenshan97 panicle, score: 89.623 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0610886230 AG A 0.01 0.02 0.02 0.0 0.03 0.04
vg0610886230 AG GG -0.04 -0.05 -0.01 -0.03 -0.02 0.0
vg0610886230 AG TG -0.04 -0.05 -0.02 -0.05 -0.04 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610886230 9.16E-06 NA mr1065 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 4.89E-06 NA mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 5.44E-06 3.14E-09 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 2.98E-09 NA mr1087 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 1.10E-09 3.26E-10 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 2.01E-06 NA mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 6.59E-06 NA mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 3.41E-06 NA mr1108 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 8.83E-06 NA mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 NA 2.26E-07 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 8.04E-08 NA mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 2.12E-07 1.56E-08 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 2.67E-06 NA mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 7.19E-06 3.90E-09 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 6.82E-06 NA mr1234 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 NA 2.22E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 NA 2.87E-07 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 3.02E-07 NA mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 1.51E-06 6.64E-11 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 1.87E-07 NA mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 9.68E-07 NA mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 1.83E-08 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 3.67E-10 1.84E-13 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 1.44E-06 NA mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 1.07E-06 NA mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 8.75E-06 1.68E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 1.52E-07 NA mr1218_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 7.10E-06 NA mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 3.44E-06 NA mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 1.98E-06 NA mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 6.40E-07 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 NA 5.24E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 8.78E-07 8.78E-07 mr1474_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 7.83E-08 1.98E-10 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 1.88E-06 NA mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 NA 5.53E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 1.17E-06 NA mr1695_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 5.04E-06 3.09E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 NA 7.00E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610886230 NA 7.27E-08 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251