| Variant ID: vg0610880175 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10880175 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.02, T: 0.01, others allele: 0.00, population size: 126. )
CAAGAAGTTGTTTAGAACGCAGCCACTTGGATCGTATGATGGCGTGAGCATTATTATCGGCTAGTCTATGTTTAGCAATATAAAACAGTGGGATGAGGAT[C/A,T]
CTTTATCATAATGTTACTACCATTACCATTACAGAGACTGATACGTGGTATTAGCCAAATTTACCGCATTTTATTCGGGCCAAGAGTACAGTGTTACTTG
CAAGTAACACTGTACTCTTGGCCCGAATAAAATGCGGTAAATTTGGCTAATACCACGTATCAGTCTCTGTAATGGTAATGGTAGTAACATTATGATAAAG[G/T,A]
ATCCTCATCCCACTGTTTTATATTGCTAAACATAGACTAGCCGATAATAATGCTCACGCCATCATACGATCCAAGTGGCTGCGTTCTAAACAACTTCTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.30% | 12.00% | 0.00% | 0.00% | T: 1.63% |
| All Indica | 2759 | 77.20% | 20.10% | 0.00% | 0.00% | T: 2.75% |
| All Japonica | 1512 | 99.40% | 0.50% | 0.00% | 0.00% | T: 0.07% |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.30% | 8.60% | 0.00% | 0.00% | T: 0.17% |
| Indica II | 465 | 84.70% | 15.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 63.60% | 29.60% | 0.00% | 0.00% | T: 6.79% |
| Indica Intermediate | 786 | 77.70% | 20.60% | 0.00% | 0.00% | T: 1.65% |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.00% | T: 0.20% |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610880175 | C -> T | LOC_Os06g19130.1 | upstream_gene_variant ; 862.0bp to feature; MODIFIER | silent_mutation | Average:63.699; most accessible tissue: Callus, score: 78.01 | N | N | N | N |
| vg0610880175 | C -> T | LOC_Os06g19120.1 | downstream_gene_variant ; 2869.0bp to feature; MODIFIER | silent_mutation | Average:63.699; most accessible tissue: Callus, score: 78.01 | N | N | N | N |
| vg0610880175 | C -> T | LOC_Os06g19120-LOC_Os06g19130 | intergenic_region ; MODIFIER | silent_mutation | Average:63.699; most accessible tissue: Callus, score: 78.01 | N | N | N | N |
| vg0610880175 | C -> A | LOC_Os06g19130.1 | upstream_gene_variant ; 862.0bp to feature; MODIFIER | silent_mutation | Average:63.699; most accessible tissue: Callus, score: 78.01 | N | N | N | N |
| vg0610880175 | C -> A | LOC_Os06g19120.1 | downstream_gene_variant ; 2869.0bp to feature; MODIFIER | silent_mutation | Average:63.699; most accessible tissue: Callus, score: 78.01 | N | N | N | N |
| vg0610880175 | C -> A | LOC_Os06g19120-LOC_Os06g19130 | intergenic_region ; MODIFIER | silent_mutation | Average:63.699; most accessible tissue: Callus, score: 78.01 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610880175 | 2.65E-06 | NA | mr1067 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610880175 | NA | 6.26E-06 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610880175 | 7.11E-06 | 5.89E-07 | mr1218 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610880175 | NA | 2.17E-08 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610880175 | NA | 3.85E-06 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610880175 | NA | 9.44E-09 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610880175 | 3.31E-06 | NA | mr1067_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610880175 | NA | 5.40E-09 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610880175 | NA | 1.21E-06 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610880175 | NA | 3.04E-06 | mr1946_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610880175 | NA | 3.04E-06 | mr1948_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |