\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610878296:

Variant ID: vg0610878296 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10878296
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


GAATATAAATATTTCTTAGGTAGTCTGTATACAAATACAGATATAATATCAGAGTTTTCGACGGATACGACTATCCAATGAATAATACTATTCGGATATC[C/T]
GCTAAAGACATAAAACATACTTATTTTGTTTCTAACTCTAGACCTTCAGCATACCTATTTAGATTTTACTAGAGCTTTATAAATTATACCAGTCCACACT

Reverse complement sequence

AGTGTGGACTGGTATAATTTATAAAGCTCTAGTAAAATCTAAATAGGTATGCTGAAGGTCTAGAGTTAGAAACAAAATAAGTATGTTTTATGTCTTTAGC[G/A]
GATATCCGAATAGTATTATTCATTGGATAGTCGTATCCGTCGAAAACTCTGATATTATATCTGTATTTGTATACAGACTACCTAAGAAATATTTATATTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.00% 13.00% 0.02% 0.00% NA
All Indica  2759 79.80% 20.20% 0.04% 0.00% NA
All Japonica  1512 96.90% 3.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.40% 8.60% 0.00% 0.00% NA
Indica II  465 84.50% 15.30% 0.22% 0.00% NA
Indica III  913 70.20% 29.80% 0.00% 0.00% NA
Indica Intermediate  786 79.30% 20.70% 0.00% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 92.50% 7.50% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610878296 C -> T LOC_Os06g19110.1 upstream_gene_variant ; 3152.0bp to feature; MODIFIER silent_mutation Average:31.774; most accessible tissue: Callus, score: 71.774 N N N N
vg0610878296 C -> T LOC_Os06g19130.1 upstream_gene_variant ; 2741.0bp to feature; MODIFIER silent_mutation Average:31.774; most accessible tissue: Callus, score: 71.774 N N N N
vg0610878296 C -> T LOC_Os06g19120.1 downstream_gene_variant ; 990.0bp to feature; MODIFIER silent_mutation Average:31.774; most accessible tissue: Callus, score: 71.774 N N N N
vg0610878296 C -> T LOC_Os06g19120-LOC_Os06g19130 intergenic_region ; MODIFIER silent_mutation Average:31.774; most accessible tissue: Callus, score: 71.774 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610878296 3.70E-06 NA mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610878296 8.10E-06 NA mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610878296 NA 1.85E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610878296 2.14E-06 3.24E-07 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610878296 4.98E-06 4.76E-09 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610878296 NA 2.38E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610878296 NA 1.48E-06 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610878296 NA 2.31E-09 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610878296 9.02E-08 NA mr1067_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610878296 6.74E-06 NA mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610878296 2.79E-08 NA mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610878296 NA 5.41E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610878296 NA 1.06E-06 mr1946_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610878296 NA 1.06E-06 mr1948_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251