\
| Variant ID: vg0610873345 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10873345 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 100. )
AGGATGATGGCGAGTAAGGATGCCACGAAGGCAGTTGAGTTGAAATAGAAAAATGTCTTATACCGCTTAGCATTAATTGTTAGGAGAATTGGGTCACCAG[C/G]
CTTGTGGCCATCCTTGTCAACCTGCCAATAACCACCCGGCGGGTCAAGCACTGCTTGGTAAGTTATGGTTGCTGCCAGAGTGGCGAGCAATAGAACAAGA
TCTTGTTCTATTGCTCGCCACTCTGGCAGCAACCATAACTTACCAAGCAGTGCTTGACCCGCCGGGTGGTTATTGGCAGGTTGACAAGGATGGCCACAAG[G/C]
CTGGTGACCCAATTCTCCTAACAATTAATGCTAAGCGGTATAAGACATTTTTCTATTTCAACTCAACTGCCTTCGTGGCATCCTTACTCGCCATCATCCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.80% | 45.70% | 0.21% | 0.25% | NA |
| All Indica | 2759 | 83.30% | 16.10% | 0.29% | 0.33% | NA |
| All Japonica | 1512 | 8.30% | 91.40% | 0.13% | 0.13% | NA |
| Aus | 269 | 17.10% | 82.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.30% | 5.20% | 0.34% | 0.17% | NA |
| Indica II | 465 | 96.10% | 3.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 73.60% | 25.60% | 0.11% | 0.66% | NA |
| Indica Intermediate | 786 | 78.60% | 20.60% | 0.51% | 0.25% | NA |
| Temperate Japonica | 767 | 4.20% | 95.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 15.10% | 84.50% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 7.50% | 92.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 19.80% | 80.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 40.00% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610873345 | C -> G | LOC_Os06g19110.1 | missense_variant ; p.Ala403Pro; MODERATE | nonsynonymous_codon ; A403P | Average:59.893; most accessible tissue: Zhenshan97 panicle, score: 76.605 | benign |
0.044 |
DELETERIOUS | 0.04 |
| vg0610873345 | C -> DEL | LOC_Os06g19110.1 | N | frameshift_variant | Average:59.893; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610873345 | NA | 7.76E-24 | mr1020 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 4.00E-06 | 3.20E-17 | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 3.40E-08 | 3.86E-67 | mr1065 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 8.20E-06 | 7.16E-12 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 1.49E-46 | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 3.97E-11 | 2.55E-73 | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 3.68E-08 | 6.18E-14 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 1.26E-07 | 2.05E-59 | mr1078 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 6.64E-17 | 4.97E-79 | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 7.43E-10 | 2.44E-17 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 2.12E-16 | 2.23E-80 | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 6.27E-08 | 2.11E-11 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 1.12E-06 | 1.66E-45 | mr1091 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 2.14E-06 | 3.72E-10 | mr1091 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 8.83E-08 | 1.65E-45 | mr1094 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 3.00E-06 | 4.84E-08 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 6.32E-11 | 1.77E-65 | mr1096 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 8.75E-08 | 1.16E-10 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 9.27E-09 | 1.39E-57 | mr1108 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 6.93E-07 | 2.33E-14 | mr1108 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 3.35E-41 | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 1.67E-08 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 8.63E-08 | 1.43E-58 | mr1111 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 9.84E-09 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 1.16E-08 | 3.73E-56 | mr1112 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 1.53E-07 | 2.28E-12 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 5.51E-09 | 6.00E-59 | mr1121 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 1.63E-07 | 1.17E-09 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 5.68E-08 | 2.12E-54 | mr1144 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 2.09E-06 | 4.60E-09 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 1.33E-07 | 4.86E-20 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 4.87E-48 | mr1200 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 5.08E-09 | mr1200 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 4.09E-10 | 1.41E-63 | mr1211 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 6.08E-06 | 1.79E-08 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 1.04E-16 | mr1218 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 1.55E-06 | mr1218 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 3.83E-30 | mr1221 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 7.92E-08 | 1.75E-57 | mr1234 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 9.97E-06 | 3.65E-11 | mr1234 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 5.72E-36 | mr1237 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 3.16E-07 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 7.62E-23 | mr1244 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 3.46E-07 | 8.17E-18 | mr1478 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 2.43E-52 | mr1526 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 8.50E-08 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 1.94E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 5.94E-07 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 7.36E-29 | mr1877 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 2.39E-22 | mr1971 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 1.44E-08 | 1.18E-76 | mr1065_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 6.42E-06 | 6.37E-15 | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 2.63E-57 | mr1067_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 1.94E-11 | 1.05E-85 | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 1.37E-08 | 3.79E-17 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 1.03E-07 | 4.39E-74 | mr1078_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 2.27E-10 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 1.79E-17 | 6.01E-92 | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 5.48E-09 | 1.70E-20 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 2.01E-17 | 2.43E-92 | mr1090_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 7.36E-10 | 3.52E-16 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 3.91E-07 | 1.68E-57 | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 7.70E-06 | 2.05E-11 | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 1.94E-07 | 7.31E-55 | mr1094_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 5.95E-06 | 2.67E-09 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 1.15E-10 | 1.87E-75 | mr1096_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 4.47E-09 | 1.39E-14 | mr1096_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 2.24E-08 | 2.71E-67 | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 1.40E-07 | 2.44E-17 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 5.68E-42 | mr1110_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 4.97E-09 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 1.08E-08 | 2.90E-64 | mr1111_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 9.78E-07 | 6.84E-13 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 9.24E-06 | 8.85E-68 | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 7.99E-07 | 3.63E-14 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 4.89E-06 | 7.29E-60 | mr1121_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 2.36E-07 | 9.13E-12 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 2.69E-08 | 3.48E-64 | mr1144_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 1.32E-06 | 3.75E-12 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 2.66E-10 | 1.30E-25 | mr1165_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 7.47E-11 | 1.94E-12 | mr1165_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 1.01E-06 | 2.84E-63 | mr1200_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 1.36E-06 | 1.87E-14 | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 5.68E-09 | 1.74E-68 | mr1211_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 5.15E-06 | 3.25E-10 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 9.42E-21 | mr1218_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 4.85E-06 | 6.49E-39 | mr1221_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 5.37E-07 | 1.03E-66 | mr1234_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 3.87E-07 | 2.92E-16 | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 2.12E-25 | mr1244_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 6.51E-06 | 6.51E-06 | mr1477_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 7.26E-10 | mr1478_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 2.29E-10 | 2.60E-70 | mr1526_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 3.61E-06 | 9.75E-13 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | NA | 2.19E-27 | mr1877_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 7.88E-07 | 5.38E-25 | mr1971_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610873345 | 3.93E-08 | 3.93E-08 | mr1971_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |