Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610866929:

Variant ID: vg0610866929 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10866929
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGCTTGCCTTGTGGAACGTGGCCTTCTGAAGCTTCAGCTTAGCCTTCTAGGTCCACTTCAGTTCCTGCGAGTCCAGTGGGATCTTCAACGCGATCTATC[G/A]
TACGCACATGAAGAAACGACCAAATAAGCCTATAATAAAAATACTACAAATAAACGATAAAATAAATATTATGAATCGGAGCCTGAGCAAAAGAAAATGA

Reverse complement sequence

TCATTTTCTTTTGCTCAGGCTCCGATTCATAATATTTATTTTATCGTTTATTTGTAGTATTTTTATTATAGGCTTATTTGGTCGTTTCTTCATGTGCGTA[C/T]
GATAGATCGCGTTGAAGATCCCACTGGACTCGCAGGAACTGAAGTGGACCTAGAAGGCTAAGCTGAAGCTTCAGAAGGCCACGTTCCACAAGGCAAGCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.60%	0.30%	1.59%	34.53%	NA
All Indica	2759	43.80%	0.50%	2.46%	53.28%	NA
All Japonica	1512	92.60%	0.00%	0.33%	7.08%	NA
Aus	269	91.10%	0.00%	0.37%	8.55%	NA
Indica I	595	17.30%	1.00%	2.18%	79.50%	NA
Indica II	465	44.50%	0.20%	2.58%	52.69%	NA
Indica III	913	54.90%	0.50%	2.63%	41.95%	NA
Indica Intermediate	786	50.50%	0.10%	2.42%	46.95%	NA
Temperate Japonica	767	96.90%	0.00%	0.39%	2.74%	NA
Tropical Japonica	504	85.50%	0.00%	0.40%	14.09%	NA
Japonica Intermediate	241	93.80%	0.00%	0.00%	6.22%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	65.60%	0.00%	1.11%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610866929	G -> A	LOC_Os06g19095.1	3_prime_UTR_variant ; 297.0bp to feature; MODIFIER	silent_mutation	Average:8.776; most accessible tissue: Callus, score: 51.866	N	N	N	N
vg0610866929	G -> A	LOC_Os06g19090.1	downstream_gene_variant ; 4346.0bp to feature; MODIFIER	silent_mutation	Average:8.776; most accessible tissue: Callus, score: 51.866	N	N	N	N
vg0610866929	G -> A	LOC_Os06g19100.1	downstream_gene_variant ; 2044.0bp to feature; MODIFIER	silent_mutation	Average:8.776; most accessible tissue: Callus, score: 51.866	N	N	N	N
vg0610866929	G -> A	LOC_Os06g19110.1	downstream_gene_variant ; 4880.0bp to feature; MODIFIER	silent_mutation	Average:8.776; most accessible tissue: Callus, score: 51.866	N	N	N	N
vg0610866929	G -> DEL	N	N	silent_mutation	Average:8.776; most accessible tissue: Callus, score: 51.866	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610866929	NA	2.89E-06	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610866929	NA	4.37E-06	mr1255	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610866929	2.78E-06	6.57E-07	mr1229_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610866929	NA	5.99E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610866929	NA	1.55E-06	mr1597_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610866929	NA	6.53E-06	mr1597_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610866929	NA	6.33E-06	mr1629_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610866929	NA	1.87E-06	mr1863_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610866929	1.96E-06	3.03E-07	mr1880_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251